Thursday, October 21, 2021
  Intelligence  
The Intelligence being described herein is rarely acknowledged in modern society and largely an unknown.
For more information about this Intelligence, see HERE, HERE and HERE, for example).

EvolutionIsTrue™
Part 1 ♦ Darwinism, Creationism … How About Neither?  [Source]
darwinism v intelligent design

Is Creationism true? Or is Darwinism true? And why would it have to be one or the other? It seems it hasn't occurred to many people that both might be wrong. Since both of them, despite what they might claim, are more about ideology than science, it shouldn't really be too surprising that science doesn't really support either, at least not in the form they're presented.

Most people who believe in Creationism do so because they were raised Christians, and they believe in the Bible (a bit too literally at that). On the other hand, there seem to be three main reasons why people believe in Darwinism: they've been taught it at school, they only have a vague sense of the underlying science (or the lack thereof, as we'll see), and/or they're convinced Creationism is nonsense and believe their only other option is Darwinism. There are, however, some serious problems with all three of these justifications.

First, the way Darwinism is taught in schools is extremely deceptive and would require an article of its own, but I will outline what's wrong with Darwinism in general and with the way it is presented to us.

Second, the vague knowledge of the science and facts relevant to evolution that most people have actually prevents them from seeing the countless problems of Darwinism. The notion that organisms evolved step by step is easy to swallow when you have no clear idea what exactly these steps would have to be and how exactly the mechanism of evolution is supposed to work. Without a clear sense of what the cell looks like, what it contains, how complex it is, how it works, and what DNA does, you're only left with the talking points that affirm that it all really does work and that science has proved it (and that only ignorant people question it.) You rarely get to hear how flimsy this science actually is, how elusive the proofs are, and how many scientists disagree with the mainstream narrative. Anti-Darwinian ideas are often literally banned from schools, usually on the false premise that they're not scientific. True scientific reasoning is sorely lacking in Darwinism itself however.

Third, Darwinism and Creationism aren't our only choices. This is not an election where you have to choose between two candidates. Just like with a choice between two presidential candidates, if you allow yourself to be convinced that those are your only options, you've already lost. The assumptions that anyone who isn't a Darwinist must be a Creationist and that if you're not a Creationist, you have to be a Darwinist, are false.

There's Creationism, there's Darwinism, and then there's the truth. This rarely noticed third option is what I want to focus on in this article. And to find the truth, we must identify the lies. I won't talk about Creationism, because it's based on a fictional book and it's about trying to fit facts into the book's narrative. Besides, no amount of proof will move Creationists from their beliefs. My point is to show to people who passively believe Darwinism is true but have never done any serious research to confirm or deny this, that Darwinism has massive flaws and identifying them doesn't have to lead us towards Creationism.

My basis for the argument against Darwinism is science, especially scientific discoveries from the last few decades. Darwinism is stuck in the first half of the 20th century. There's no need to invoke God to show that Darwinian evolution doesn't work as described. Science does the job. Believing in the ability of Darwinism to explain evolution is not about how much you know but about how much you're willing to ignore.

It should also be noted that, in general, we're talking about things for which there is often insufficient clear evidence, and much of the evidence we have is subject to interpretation. Different people have different interpretations of the same facts, largely influenced by their particular world views and beliefs. Some things we know for sure, but many things are much less clear. In any theory of evolution we are by definition dealing with events and processes that occurred long ago, and we can study some of them only from scattered pieces of evidence that don't include the complete context required to understand them fully. In many cases, we must simply acknowledge that we don't know and that our differing beliefs are based on theories and speculations.

I will divide this article into three main parts: what exactly the Darwinian process of evolution is and how it's supposed to work, why it doesn't and can't do what it claims to do, and what that means for us.

What the Darwinian Theory of Evolution Really Says

The process by which evolution supposedly happens is Natural Selection (NS) acting upon Random Mutation (RM). RM means errors that occur in DNA. NS is a passive natural process that just notes that whatever survives long enough to reproduce gets to pass on its genes. RM is the driving force that provides raw material; NS is what's supposed to sort it out and separate the good from the bad. In reality, not only is the raw material provided by randomness of inferior quality, as you might expect, but NS has far less power than the Darwinists would have you believe.

To appreciate how it all works, we need to have some idea about what happens in the cell and what exactly these mutations are. How well could you answer questions like these:

  • How complex is a cell?
  • What exactly is DNA and what does it do?
  • What is the relationship between DNA, a gene, and a chromosome?
  • What are amino acids and what do they do?
  • What are proteins, where do they come from, and what function do they serve?
  • When we talk about mutations, what exactly mutates, where and how?
If you believe in Darwinian evolution and don't know the answers to these questions, then you have only a vague idea about how evolution supposedly works. You understand what the results are supposed to be, because you've been told, but you don't understand how exactly it works on the molecular level. I don't blame anyone for not knowing this. I had lived most of my life not knowing it either. But there's a slight problem with that in regard to evolution. Once you do understand how DNA and all the things around it work and what they do, Darwinism as a theory begins to fall apart because it becomes incredibly implausible. You suddenly realise, "Wait, what? That's how evolution works?"
DNAstructure

So let me first explain some basics of what goes on inside a cell. This will get a bit technical for a few paragraphs.

You've probably seen the DNA helix. It's like a long twisted ladder. Each step of the ladder is called a base pair. There are only four bases: A[denine], T[hymine], C[ytosine], and G[uanine]. A always connects to T, and C always connects to G. So it looks something like this:

A--T
G--C
C--G
T--A
C--G
A--T
A--T
G--C

A very long string of such DNA, up to hundreds of millions of base pairs, nicely folded, forms a chromosome. Humans have 46 such chromosomes in the nucleus of each cell. A gene is a section of a chromosome. Among other things, it's a set of instructions (a string of the ATCG code) for building a protein. A chromosome can contain anything from hundreds to a few thousand genes.

RNA is like DNA but with only one strand (one side of the ladder) and has many functions, and many things inside a cell are built from RNA.

The DNA code of sequences like TCGATCACGTACAGGTCAGC is similar to our computer code with sequences like 10010110101101001. A sequence of 1s and 0s may contain instructions for how to play a video file; a sequence of the four letters A, T, G and C contains instructions for coding proteins and much more. The 46 chromosomes in each human cell contain all the information needed to build and maintain the whole human body.

To get an idea how complicated this all is, let me outline how proteins are made. An enzyme attaches itself to DNA, runs through it (or part of it), copying one of the strands and thus creating mRNA (messenger RNA). Specific sequences of letters will tell it where a gene begins and ends (kind of like headers in computer files). So it creates mRNA that's more or less a copy of one gene. (All processes are actually more complicated, but I won't get into introns and such things.) Now a ribosome (made itself from RNA and some proteins) attaches itself to the mRNA and starts "reading" it, codon by codon. A codon is a set of three nucleotides, for example ACG. (A nucleotide is the base plus the part of the DNA/RNA backbone that it attaches to. For our purposes, the difference between a base and a nucleotide is negligible).

For every codon, the ribosome needs to find tRNA with the correct anticodon. tRNA (transfer RNA) is a fairly small chunk of RNA with the anticodon on one end and a corresponding amino acid on the other. An anticodon is the complementary sequence to a codon, so if the mRNA has CCC, the tRNA needs to have GGG, in order to fit. A tRNA with GGG always carries the same amino acid. The tRNA molecules sort of float around, and when the ribosome finds the right one, it gets attached, and its amino acid is handed over to the ribosome. Then the mRNA shifts to the next codon in the ribosome, waiting for the ribosome to find the next tRNA and thus another amino acid. The amino acids get connected together and form a long chain - a protein, which will be dozens to thousands of amino acids long. Proteins then do all kinds of work in the body.

human cell

You don't really have to understand this; the reason I'm describing it is to give you just a little insight into the complexity of the processes that go on in every single cell, all the time. There is of course infinitely more than this. A cell is like a busy city, with countless things going on simultaneously, and none of it is simple. Things have to be transported from place to place, you have to make things that make other things, and so on.

The image at right is of a single cell - the basic unit of organic life. The smallest things you see here, ribosomes, are complex machines that play a major role in translating mRNA into proteins. None of this is even remotely simple.

John Sanford explains in Genetic Entropy:

quote big

A complete human genome consists of two sets of 3 billion individual letters each.

In addition to multiple, overlapping, linear, language-like forms of genetic information, the genome is full of countless loops and branches, like a computer program. It has genes that regulate genes that regulate genes. It has genes that sense changes in the environment and then instruct other genes to react by setting in motion complex cascades of events that can then respond to the environmental cue. Some genes actively rearrange themselves, or modify and methylate other gene sequences, basically changing portions of the instruction manual!

The inner workings of a cell are incredibly complex, and the information contained in it (remember that all the chromosomes with all the DNA are in the nucleus) is mind-boggling. The ATCG code of DNA is just its most basic element. There are control regions, there's DNA folding, and many levels of complexity above the code itself.

Now that we have some idea about what the code that builds everything looks like, let's move to what random mutations are. Say at one specific point in the DNA you have an A--T base pair. A copying process reading the A makes a mistake of some kind. This is the mutation. There are several variations of what can happen. The A can be changed into any of the other three bases, so instead of A--T, you can get T--A, C--G, or G--C. Another option is that the A gets skipped/deleted, and the deletion can cover any number of base pairs. Then there's insertion, which means that before the A, one or more bases get inserted from somewhere else, and our A shifts in the sequence. There's also duplication, meaning the A, or even a whole sequence like AACGCTTC, gets copied an extra time, or two, or 25. So, basically, random mutations are the various glitches that can occur to this ATCG code in the DNA.

Most of these glitches, like any errors anywhere, won't result in anything good. If you have a piece of a gene, or of DNA, like ACGTAGGCA, it will be divided during protein translation into ACG, TAG, and GCA, and these will code for three amino acids. But if something gets inserted at the beginning, say G, you get GACGTAGGCA, which then splits into GAC, GTA, and GGC, which codes for completely different amino acids than the original sequence, because the whole code sequence was shifted. Similar shifting would occur with a single deletion. Because these sequences are functional and very specific in the first place, it is extremely unlikely that any error will produce anything that works better than the original - in fact, it may not work at all.

The genetic code is something that works well as it is. Random mutation introduces random changes to the code. For comparison: a book is something that works as it is. Random mutation would introduce random changes to the letters of the text. The idea of getting a new functional organ in the body this way is akin to getting a new functional (i.e. intelligible) chapter in a book this way. But this is the core mechanism by which Darwinists claim all life on Earth has evolved! If you imagine the book as an instruction manual for building something specific, what are the chances that random changes in the manual will result in building something better? I'm sure you can see that the chances are practically zero. And as we'll see later, natural selection can do little to help.

According to Darwinism, a bacterium has, literally, accidentally evolved into a human through the accumulation of random copying errors in its DNA. Please take a few minutes to ponder how dumb this idea is.

Does it make sense that randomness creates complex, functional order? Something that's functional, that works, that does things, doesn't appear randomly. Can you imagine randomly shuffling or changing some of the components of a functional device, like a smart phone, with the result that it works better? Clearly, making random errors is not the way to improve a functional system.

Darwinists believe that this is where natural selection (NS) steps in and fixes everything. But NS can only act on something that's there, and what's there is random changes. If what NS has to work with are random changes to something that already works, there's extremely little space for improvement of any kind.

DNAfolding
From DNA to chromosome: according
to Darwinists, this is the product of
accidental self-assembly, and it
evolved through random errors.
Nevertheless, it just happens to know
how to build an intelligent human
being. No intelligence involved in the
process, though. Stuff 'just happens'.

Everyone seems to agree that genetic code is more sophisticated and complex than anything humans have ever designed. So think about this:

  • It takes the smartest of us, and a lot of effort, to intelligently design the sophisticated technology we have today, like supercomputers.
  • Yet according to Darwinists, something much more complex than anything we've ever designed just arose out of random errors.

And whatever you know about any of this, you're most likely greatly underestimating the complexity involved. Here's what Sanford has to say about DNA:

quote big

There is abundant evidence that most DNA sequences are polyfunctional, and are, therefore, poly-constrained. This fact has been extensively demonstrated by Trifonov (1989). For example, most human coding sequences encode for two different RNAs that read in opposite directions (i.e., both DNA strands are transcribed - Yelin et al., 2003). Some sequences encode for different proteins, depending on where translation is initiated and where the reading frame begins (i.e., read-through proteins). Some sequences encode for different proteins based upon alternate mRNA splicing. Some sequences serve multiple functions simultaneously (i.e., as a protein-coding sequence and as an internal transcriptional promoter). Some sequences encode for both a protein-coding region and a protein-binding region.

So the same chunk of DNA can code for several different things, depending on how it's read and translated. Even if by introducing random changes to one function of a multifunctional operation were to, by chance, improve one function, it would most definitely break the other functions. Darwinism is a theory that claims insurmountable obstacles are regularly being overcome, again and again, like it's the most natural thing.

If you let it sink in, you'll see that the more you think about it, the more it looks like the dumbest theory ever conceived.

Can you think of one example of something in our world where a random process creates something complex and functional? Random processes can at best create interesting patterns, but those don't do anything. One might argue that, maybe, once in a very long time, a number of random mutations could somehow accumulate and produce something new and complex. Let's allow that, for the sake of argument (though we will see that this is just a dream, for many reasons). But how many such mutation complexes, each consisting of dozens to hundreds of single mutations, do you think you'd need to get from a fish to a bear? Hundreds? Thousands? And you'd need the same for all the other species. With every new step, the probability drops by orders of magnitude. And for evolution to work as described, this would have to happen all the time. Billions of such sequences of events would have to occur, where even one is massively improbable, if possible at all.

If you ask, 'where did all this life come from?', Creationists say, 'God did it'. Darwinists say this explanation is lazy. But if you ask them to answer that question, they'll say 'it happened randomly'. That's an even lazier explanation, and makes even less sense. The whole Darwinian view of how things work is extremely simplistic and naive. (Just like Creationism).

The principle of entropy says that, over time, everything degrades, moves from more complicated and unusual to more simple and normal, from a state of lower probability to a state of higher probability, from order to disorder. But the theory of evolution directly contradicts entropy. According to it, information in the genome gets progressively more complex on its own, by a random process, with no intelligent input. This is illogical and nonsensical. Meaningful information doesn't arise randomly, and consciousness doesn't accidentally spring from dead matter. Yet that is exactly what Darwinism relies on to work. It claims that a random process with no intelligence and no goal produces information, consciousness, and intelligence. Your reading this and thinking about it is a result of molecules long ago randomly assembling into functional genes, which later led to creating you and your thoughts - as a completely random side effect! That's the story. But nothing in our world works like that. You can't get more out of something than you put in. If the input is random garbage (mutation, errors), the output can't be something functional and more complex than the original.

The Many Shortcomings of Darwinism

Let me start this part with a little example. The other day I was reading Richard Dawkins's The Greatest Show on Earth, his only book where he even tries to explain why Darwinism is true. (In all his other books, by his own admission, he simply assumes it's true and starts from there.) Here he mentions something from Richard Lenski's experiment with E. Coli. (Lenski has been breeding and studying E. Coli for decades. It's one of the most extensive real-life experiments with 'evolution').

Dawkins says one of the groups of the bacteria evolved mutation A, which on its own "did absolutely nothing", and then later evolved mutation B, which on its own also did absolutely nothing, but because mutation A was already present, they did something together. (It took tens of thousands of generations to get there.)

According to Dawkins, this shows "evolution right in front of our eyes", shows that "new information can enter the genome", and "undermines the dogma of irreducible complexity." If your only sources of information about evolution are school textbooks and Dawkins, and you don't think about things much, you might not see a problem with this. But there are several, and this is a good representation of how Darwinists regularly distort things.

  1. Dawkins doesn't tell us anything about what A and B were and what they did together. This gives us little idea of what's really going on.
  2. He fails to mention what "new information" appeared and how it was really new, rather than just a modification of the old.
  3. His notion of 'complexity' is two (2) parts.
  4. He says nothing about how "mutation A" passed through natural selection when it did "absolutely nothing" without mutation B.
  5. Of course it wouldn't occur to him to even wonder how the genetic code might have been damaged by whatever happened there.
This is very typical for Dawkins. Let's look at this in more detail.

1. Without knowing exactly what he's talking about, we have little choice but to accept his interpretation of what happened. But that's a huge problem. The information given is deliberately vague, and thus it's impossible to judge whether his interpretation is correct. And this is a key element of the manipulation by people like Dawkins and by our poor education systems: you don't get facts; you get interpretation of data with insistence that it's a fact. In contrast, if you read Michael Behe's books, which explain why Darwinism cannot account for much of evolution, you get everything explained down to the minutest details, so you can understand very clearly what's going on, and you can much better judge whether you're being lied to.

2. As you might already have deduced after reading the first part of this article, there's no real way to get 'new information' into the genome by random mutations. Everything is just a modification of what's already there, and those modifications are a thousand times more likely to break something than improve it. Dawkins says that new information entered the genome, but we have no idea what it is and thus whether this claim is true.

3. Irreducible complexity is explained in great detail in Behe's book Darwin's Black Box. To recapitulate quickly: if you have a system of 20 parts that are all needed for the system to work (remove any one part and the system becomes useless), the system cannot evolve step-by-step in Darwinian fashion, because you'd have 19 intermediate states that aren't useful for anything and thus NS wouldn't select them. This is one of the biggest problems for Darwinism. Dawkins claims 'victory' because he shows something evolved two parts that did something together. Two parts is the worst example of 'complexity' possible (literally), and on top of that his explanation has so many holes in it, it's not even funny.

4. Supposedly mutation A did "absolutely nothing" on its own. Then how is it possible for it to be selected by NS? This is the key element of Darwinian evolution. If it does nothing, it has no benefit to survival and therefore won't survive. So you'd expect an explanation of how it spread in the genome. Instead, Dawkins completely ignores the issue. How then are we to take seriously anything he says?

5. Whatever really went on in Lenski's experiment (we really have no clue from Dawkins's account), it's much more likely that, along with something that increased survival, some part of the genetic code broke, than that 'new information' was introduced. (I'll return to this experiment a bit later.) But Dawkins, along with most other Darwinists, ignores this as well. He sees only what he wants to see and interprets it in a way that suits his pre-formed belief.

Sadly, many people read his books with barely a basic understanding of the topic, and so they're easily convinced by his conclusions, never noticing all the manipulation, inconsistencies, fallacies, and omissions, and they think he's a genius who shows those dumb Christians how things really work. Sure, Christians may have some pretty dumb ideas, but unfortunately, Dawkins is just as ideologically-driven and therefore just as dumb.

Earlier in the book he talks about dog breeding and concludes: "If so much evolutionary change can be achieved in just a few centuries or even decades, just think what might be achieved in ten or a hundred million years." Depending on how perceptive you are, you may or may not notice that dog breeding is by design and not random. You might also notice the fact that changing the sizes, shapes and colours of dogs only ever leads to different dogs and never to cats, gorillas, or eagles. It also consistently leads to genetic defects in most of the species. Dawkins bombards you with flawed arguments and ridiculous extrapolations, constantly insisting on how amazing evolution is.

Near the end of his book, Dawkins decides to explain how evolution fights entropy. According to him, natural selection is this amazing device that apparently creates new things (thus fighting entropy), and it can do that because it's constantly powered by the Sun! We'll see later just how much NS can really do and how it doesn't 'create' anything. What the Sun has to do with it is unclear, just like many of Dawkins's other ideas. The Sun provides energy, but the entropy is of information, which is neither energy nor matter. The only thing that can fight entropy of information is consciousness/intelligence. NS can, at best, slow it down by eliminating the very worst genetic material, but it can't reverse it.

If you want to learn more about this book's fallacies, omissions, and other flaws, check this blog by David Swift, author of Evolution Under The Microscope. He exposes the many ways in which Dawkins misleads the public.

Dawkins also ignores most of 21st (even late 20th) century science, as well as any other details that are inconvenient truths for his evolution argument, but people gobble it up because they don't know any better (which he relies on), and often because they just want a scientific-sounding confirmation that Creationism is wrong. Literally every aspect of Darwinism is controversial, at the very least (and often just patently false), yet Dawkins and others act like there's so much evidence for evolution that we need not look for more, and anyone who doesn't believe in it should really read his books and keep up.

Dawkins is the epitome of what's wrong with science today in general and Darwinism in particular. His books are based on materialist ideology, where dead stuff randomly performs advanced magic all the time. He is a persuasive propagandist and manipulator (taking a leaf out of the Global Warmists' book, he calls those who don't believe in Darwinian evolution "history deniers") who dogmatically repeats that evolution is a fact, evolution is amazing, everything springs out of randomness, natural selection is ingenious (even though it has an IQ of zero), and there's no meaning in anything... but the evidence for any of that is only imaginary. He writes 'popular science', which means there is very little actual science in it, so it's hard for the layman to judge the accuracy of anything he says. Everything is his interpretation of data that's presented in all kinds of distorted ways.

This problem also extends to how Darwinism is taught in schools where students are treated to endless repetition of the 'fact' that evolution is true (the evidence for which is either lacking or false, as we'll see) and omission of scientific discoveries of the last 50-70 years that show increasing problems with Darwinism.

Icons of Evolution, a book by Jonathan Wells, focuses on exactly this. It lists a number of 'icons' - ideas that are, even today, presented in biology textbooks as proof of evolution - that have long been known to be misleading, inaccurate, and even faked. These are things that 'everyone knows' because they went to school, except they happen to not be true. I'll go through some of them briefly. For a fuller explanation, I highly recommend reading the book.

Haeckel

The image at right is a drawing of embryos of different species, showing that the early stages look almost the same for all of them. But what is omitted is the fact that these drawings were faked. Other than selecting species that are more alike than others that could have been chosen, Haeckel (who originally drew them) used the middle stages of development, while in the earliest stage, the embryos are more dissimilar, and more importantly, he intentionally changed the drawings to look more alike than they really are. Today we have actual photos of embryos, and the similarity drawn by Haeckel simply isn't there.

peppered moth

In the image at right we see a peppered moth resting on a tree trunk. Dark moths are more visible on light trees, light ones on dark trees. Supposedly, during the industrial revolution, as trees got darker due to pollution, the dark forms became more common because they were better masked and thus hidden from birds who eat them. Natural selection!

What is omitted however is that most pictures of peppered moths on tree trunks have been faked. The moths were put there by the photographers. Experiments that were supposed to show natural selection in action were poorly designed, not very scientific, and it took years for somebody to point out that peppered months don't exclusively rest on tree trunks, unless you put them there. Controversy ensued and the whole thing was a debacle, but you still see this claim in textbooks as 'proof' of evolution.

The image at right (Tab 1) shows archaeopteryx, the alleged intermediate animal between reptiles and birds. What is omitted is the fact that later science showed that "archaeopteryx is not the ancestor of modern birds, and its own ancestors are the subject of one of the most heated controversies in modern science."

The image at right (Tab 2) is a four-winged fruit fly, which supposedly proves that it's possible to evolve something new. The second pair of wings was achieved by targeted mutations in the lab. What is omitted however is that the second pair of wings is nonfunctional and even then a combination of three specific mutations was required to achieve the second pair, and the experiment was, of course, an example of intelligent design. The wings were also not just added, but rather a different organ was used to create them. It just so happens that this organ was kind of important because it helps the flies maintain balance. And of course the wings were not anything 'new' because a fly already has wings and this was just an extra pair. So these mutants gained nonfunctional extra wings that got in their way, lost an organ that was useful, and they only survived in the lab under favourable conditions. In the wild they died out because -- guess what -- natural selection did not 'select' them because they were useless!

There are more examples, like Darwin's finches that don't really evolve into anything different, or the circular reasoning of evolution resulting in homology and homology proving evolution, but this should suffice. The point is that some of the best-known examples of 'proof of evolution' are bogus, yet they're still shown to students with no mention of the controversy (at best) and fakery (at worst) surrounding them. So if you're one of those people who believe that evolution is a proven fact because that's what they taught you in school, but you've never done any research of your own into this, I recommend reading Icons of Evolution to see just how 'proven' evolution really is.

You might also ask yourself: if there's supposedly so much clear and unquestionable evidence for evolution, why are they showing you fake evidence at school? And when you complain, they tell you that critical thinking does not include questioning the proven science of evolution. That's literally the opposite of critical thinking. You should be starting to get the sense that there's something wrong with this picture. Thomas Nagel summed up the problem quite neatly when he said, "the political urge to defend science education against the threats of religious orthodoxy, understandable though it is, has resulted in a counter-orthodoxy, supported by bad arguments, and a tendency to overstate the legitimate scientific claims of evolutionary theory."

So what's really going on with Darwinism? Does it work or not? The answer to that question is, unfortunately, not a simple yes or no.

Let us assume that when Darwin first proposed his theory in 1859, he didn't know what he was talking about. This is not an attempt to denigrate him. I think he actually did pretty well, for his time. But that's the caveat: 'for his time'. Back then, science thought a cell was a blob of goo, nobody knew how heredity worked, and the discovery of DNA code was relatively far into the future. So while Darwin observed variation and natural selection quite correctly, he didn't know where this variation came from, and he, along with everyone else at the time, imagined things to be orders of magnitude simpler than they really are. The word 'imagine' is very apposite here. Darwin's theory was about what he imagined, but he had (and could have had) no idea about the limitations of the process of NS acting upon variation.

Things really went wrong later, with the modern synthesis of the Neo-Darwinists. They had a better idea of how things worked, but instead of realising the limitations, they engaged in an almost fanatical promotion of RM+NS as the explanation for everything. Too much enthusiastic dogmatism, too little science. This could have been corrected in the second half of the 20th century, but instead, the dogmatism only strengthened, and Darwinism became driven by ideology rather than science, tightly connected to materialism and atheism. The arguments for evolution became, in their dogmatism and vicious strife to claim superiority over Creationism, very similar to Creationism. The Creationists want to prove there is God, the Darwinists want to prove that there isn't, and they both ignore any facts that don't fit their thesis. Winning the fight has become more important than the truth. Meanwhile science has made huge progress that has been ignored or twisted, Dawkins-style, to suggest something other than what it really indicates.

Regarding what RM+NS really can or cannot explain, the best work I've seen is by Michael Behe. In his books The Edge of Evolution and Darwin Devolves, using recent scientific discoveries, he shows that RM+NS do explain some adaptation for survival, but cannot account for complex evolution. More specifically, according to Behe, this process can be observed on the level of species and genera, but it fails to produce anything complex enough to create a new family or anything above. The main reason is irreducible complexity, which is way beyond the ability of RM+NS, even theoretically. Over 20 years ago, Behe challenged the scientific community to explain how a flagellum could arise by the Darwinian mechanism of RM+NS. To date, nobody has been able to do that or reconcile the fact that mutations which degrade the genetic code are at least 1,000 times faster than ones which might improve it (the latter being highly unlikely in the first place.)

This is the crux of the matter for Darwinism. Random mutations & natural selection do work, in principle, as described, but there's a rather low limit of what this process can achieve. This is something that Darwinists can't, or don't want to, understand. They use the reverse logic of 'if the easy is possible, then the difficult must be possible too'. They assume mutations can do anything, like a junkie who's so high he thinks he can fly. But they can't. Dog breeding will never create dogs with wings. They have no genetic material for that, and contrary to the dreams of Darwinists, NS would destroy any such process anyway. Darwinists have continually confused change in degree with change in kind.

So what do we have evidence for? Where we provably know of evolution (though more precisely adaptation) between one studied specimen and another, we mostly see degradation of the genetic code. Where we see apparent improvement in the genetic code between two specimens, we have no direct evidence of actual evolution. Darwinists simply assume it by default.

There is evidence for the process of mutation+selection working - for example, malaria adapting to drugs, Lenski's E. Coli experiment showing that bacteria can, for example, increase the efficiency of their metabolism, cichlids in African lakes diversifying into many species, and so on. But there's clearly a ceiling for the 'evolutionary' potential in all such cases. It's more about specialisation (usually at the cost of versatility) than evolution.

Behe describes it this way:

quote big

The fundamental principle seems very likely to be this: minor random variations around a designed blueprint are possible and can be helpful, but are severely limited in scope. For new basic designs such as those at the biological level of family and above, additional information is necessary, information that is beyond the ability of mindless processes to provide.

In the few decades we've observed them, Malaria and the HIV virus have gone through as much mutation as humans have in their entire history (because there are lots of them and they have a short generation span). And what do they have to show for it? Nothing much. Did they grow anything new? No. Did they change in any observable way? No. They're just resistant to a few of our drugs, which usually involves only single mutations. The virus is still a virus, and the bacterium is still a bacterium. No change in their nature, no new function.

As for Lenski's E. Coli experiment, all apparent progress came at a cost.

quote big

… the bacterium has repeatedly thrown away chunks of its genetic patrimony, including the ability to make some of the building blocks of RNA. Apparently, throwing away sophisticated but costly molecular machinery saves the bacterium energy. Nothing of remotely similar elegance has been built. …

The lab bacteria performed much like the wild pathogens: A host of incoherent changes have slightly altered pre-existing systems. Nothing fundamentally new has been produced. No new protein-protein interactions, no new molecular machines. As with thalassemia in humans, some large evolutionary advantages have been conferred by breaking things. Several populations of bacteria lost their ability to repair DNA." This is the kind of detail you get from Behe, but not from Dawkins. The result of evolution for tens of thousands of generations is that things mostly break and nothing even remotely complex is created. Natural selection selects for survival under current conditions. It cares about nothing else. There's no planning, no concern for the overall quality of the genome.

This is one of the most important aspects of random mutation. The genetic code tends to degenerate much more than to improve, even within mutations that improve survival. An organism under stress can come up with a 'dirty hack' that helps, but breaks something much faster than with a constructive solution. And if that dirty hack ensures survival, by the time a constructive solution might come along, if it does at all, it's not needed anymore, has no effect, and NS is blind to it. This is why the beneficial (for immediate survival) but damaging (to the genetic code) mutations almost always prevail. This is explained in detail in Behe's Darwin Devolves and in Sanford's Genetic Entropy.

It's only logical that a random, unintelligent process would follow the principle of entropy. Information decreases in the system, parts of the genetic code are lost, and nothing new is created. If there's any actual innovation in organisms, it has to come from somewhere else.

So evolution (which really means surviving by mostly breaking the genetic code) is a 'proven fact' only on this low level. The rest is speculation, assumptions, and biased interpretation. The logic of "if this can happen in 20 years, imagine what can happen in 20 million years" is a fallacy. It's like showing that if you twist the Rubik's cube for 5 minutes, you can get some interesting colour patterns, and then claiming that if you continue for 5 years, the cube could become a car. There are limits to what any particular process can achieve. Darwinists insist that their random process is as omnipotent as the Creationists' God.

And it's not only RM that has limits. Natural selection is limited and even limiting too. If it took 5,000 mutations to evolve from one species to a significantly different one, and you were to introduce these mutations artificially, one every few generations, NS would actually be working against you because 99% of the mutations wouldn't be of any use on their own, so there would be no benefit for survival. And as we've seen, building something that isn't useful (yet) costs energy, so the prevailing tendency is to lose things, not gain them. NS is helpful, but only for things that are immediately beneficial for survival. Mostly this means single mutations only.

Creating something new by RM is an uphill battle even with NS. From Genetic Entropy:

quote big

The overwhelmingly deleterious nature of mutations can be seen by the incredible scarcity of clear cases of information-creating mutations. It must be understood that scientists have a very sensitive and extensive network for detecting information-creating mutations, and most geneticists are diligently keeping their eyes open for them all the time. This has been true for about 100 years. The sensitivity of this observational network is such that even if only one mutation out of a million unambiguously creates new information (apart from fine-tuning), the literature would be overflowing with reports of this happening. Yet I am still not convinced there is a single, crystal-clear example of a known mutation which unambiguously created information. There are certainly many mutations which have been described as beneficial, but most of these beneficial mutations have not created information, but rather have destroyed it.

[…]

During the last century, there was a great deal of effort invested in trying to use mutation to generate useful variation. This was especially true in my own area, plant breeding. When it was discovered that certain forms of radiation and certain chemicals were powerful mutagenic agents, millions and millions of plants were mutagenized and screened for possible improvements. […] For several decades this was the main thrust of crop improvement research. Vast numbers of mutants were produced and screened, collectively representing many billions of mutation events. A huge number of small, sterile, sick, deformed, aberrant plants were produced. However, from all this effort, almost no meaningful crop improvement resulted. The effort was an enormous failure for the most part and was almost entirely abandoned. Why did this huge mutation/selection experiment fail even with a host of Ph.D. scientists trying to help it along? Because even with all those billions of mutations there were no significant new beneficial mutations arising.

So beneficial mutations are virtually nonexistent, but many damaging ones slip through NS, which is why we have things like genetic diseases. Organisms with damaging errors in their DNA can still survive and reproduce, and these errors happen infinitely more often than anything really beneficial, so the genetic code does degrade over time. The vast majority of mutations are near neutral, so they don't affect survival and thus are invisible to NS, but they constantly introduce more and more small errors to the genetic code. That's entropy in action.

Also bear in mind that mutations happen on the nucleotide level, while NS happens on the level of the whole organism. You may have many mutations in your body, some good, most bad, but the only thing that matters for NS is whether you as a whole survive long enough to reproduce. There's no way to sort out the different mutations.

The limited power of NS is more obvious the larger the organism is. It actually works best in bacteria and viruses, where a single mutation can make a visible difference. But in a mammalian body, a single mutation, unless it breaks something really badly, will in almost all cases be invisible, drowned in thousands of other features, and won't result in any significant survival rate change. And because deleterious mutations are thousands of times more common than beneficial ones, the normal state of any organism is that it contains thousands of small, deleterious mutations. If a beneficial mutation appears, it can only survive by taking all these deleterious ones along for the ride. The overall damage is always larger than the gain. At no point will any organism have more beneficial mutations than deleterious ones.

Darwinists view NS almost as a God that can, with utmost precision, choose what survives and what doesn't. But there is no precision. 'Dumb luck' has more to do with survival than NS. As Sanford points out, if a whale swallows a few thousand shrimp in one bite, does it swallow the least fit ones? No, it's random. If salmon are swimming upstream to lay eggs, and a bear is waiting for them to catch some, what are the chances that the bear will get the least fit specimens? Pretty much zero. There are very few cases when it's actually natural selection that makes the choice, rather than any number of other factors.

NS mainly eliminates those who are so damaged that they really can't keep up with the rest. Bacteria developing resistance to drugs is one of the few examples where NS "favours something new". This is a case where a significant difference can be made with minimal effort, because it's just one mutation in a small organism. Again, in a larger organism, a single mutation is very unlikely to be visible to NS. But there's no selecting for the mutants. The selection can only be against the non-mutants. The selection here works only because the drug is literally killing off all the non-mutants. NS has no creative power. It can only eliminate. Something new that's useful will survive. But so will the normal organisms that have been surviving all along, at about the same rate, unless conditions have changed significantly. For the most part, the job of NS is to try to preserve the genetic code as it is, to prevent it from degrading. Mutations are degrading it all the time, but NS can eliminate only the worst ones. If a beneficial mutation appears, it appears in an organism that already has accumulated hundreds of small deleterious mutations, so even if the organism survives, the code is still degrading. The only thing NS can do is remove from the gene pool organisms that, for whatever reason, fail to reproduce. There is simply no way forward, in the long run. Not by this process anyway.

And keep in mind that even for the bacteria, you need thousands of generations and billions of specimens for one significantly useful mutation to show up. Bacteria just go through that process really quickly. For mammals, such a mutation might take a million years to appear, and then NS still wouldn't even see it in most cases.

Let us suppose, for the sake of argument, that a wolf is born that can run twice as fast as other wolves. This is, of course, completely unrealistic for a random mutation to achieve, but let's go with it anyway. It would be about as much as RM can be hoped to offer for NS to work with. The question here is, what can natural selection really do about it? Darwinists will claim that it will 'select for it', and just automatically assume that wolves as a species have evolved to be twice as fast this way.

But this is very naive. What happens in reality? We can safely assume this wolf will have no trouble at all catching prey. We may even assume it will eat literally any time it wants. (Though that may not necessarily be true due to low availability of prey and other conditions.) But what can NS do about this? The wolf survives, sure. But how does it affect the other wolves? They can still catch prey at exactly the same rate they did before. Natural selection can only favour this wolf by eliminating other wolves. It can't make this one reproduce more. It can only kill off other wolves if they're unable to survive. But this new wolf's ability to survive has not decreased the other wolves' ability to survive. Very much less so when they hunt in packs and whenever prey is caught, they all eat. In this case, the advantage is transferred to the whole group, but the whole group doesn't spread the new wolf's genes.

Here's where Dawkins's dumb idea of selfish genes can be seen to not work: while this wolf and its progeny may survive easily, their genes may be expected to spread only marginally better than just by genetic drift. This is pretty far from 'wolves evolving to be faster'. And note that this wolf is still prone to injury (maybe more so than others!), disease, cold, human hunting, and all the other things that threaten wolves (never mind that any such mutation is very likely to break something else in the wolf's genome.) So even if such an amazing and improbable evolutionary step occurred, there's still a decent chance that the wolf will die due to bad luck. And this bad luck is far more likely than the mutation was in the first place.

The amazing power of NS, as it exists in Dawkins's imagination, does not exist in the real world. And it's ironic but very telling that single-celled bacteria, in which NS is more powerful than in the more complex organisms, had not evolved much for two billion years.

cambri
Evolution is slow and gradual.
Like … not in this picture.

Which brings us to another of the many problems with Darwinism, the well-known Cambrian explosion. For two billion years, only single-celled organisms existed, without producing anything complex. This makes perfect sense. What doesn't make any sense (from the Darwinian perspective) is that then, suddenly, in some 20 million years, most major animal phyla appeared in all their complexity. The Darwinian prediction is that things evolve slowly at a fairly constant rate. The Cambrian explosion stands in complete opposition to this theory. Of course Darwinists, who begin with a pre-formed belief - that evolution is true - and then try to twist the facts to fit the conclusion, have all kinds of really lame excuses for this that we won't even get into here.

The funny thing to consider is that if anything in this image is caused by random mutations, it is more likely to be the decline of species rather than their creation. Rather than the evolution of species, random mutation is more likely to play a role their extinction. The irony of that fact is epic.

Something else that Darwinists regularly confuse is 'consistent with' and 'evidence for'. Wherever they see something that's even remotely consistent with evolution, they claim it's evidence for evolution. It doesn't occur to them that, aside from this being a fallacy, 90% of the time this said 'evidence' is actually also consistent with the main competing theory - Intelligent Design.

Common Ancestry

Common ancestry is not actually proven. It's not a fact; it's an interpretation of a fact, the fact that different organisms look anatomically similar and thus are presumably related. But are we looking at common ancestry or a common designer? Similarity of design of different organisms makes perfect sense from the point of view of ID. If you're going to design a new car, are you going to design it from scratch, including reinventing the wheel? Of course not. You'll start with a car that's close to what you want and make modifications of your choice. Similarity of anatomy is no proof of evolution, especially when it fits the opposing theory just fine. Of course this is where Darwinists really embarrass themselves by telling you how God would or wouldn't design things. Being materialist atheists who deny the existence of anything approaching an idea of God, Darwinists are of course the chief experts on what God would or wouldn't do.

If you line up a hundred different cars and invite a Darwinist from another planet where there are no cars to take a look, he will immediately see the common ancestry of these cars, the homology, and clear evidence that these cars evolved from one ancestor, and that there's absolutely no need for design. He'll be able to line up the cars in the order in which they had probably evolved. Clear evidence, right? Nobody designed the cars. This may seem silly, but it's really quite an accurate analogy for how Darwinists 'prove' common ancestry. Of course similarity of structure is not proof of common design either! It's just resemblance, consistent with both theories, that can be interpreted in different ways, as I warned at the beginning of this article. But Darwinists use it as 'proof' of evolution, which is false proof.

I won't even try to get into the case of humans specifically. Humans in the context of evolution are such a controversial topic that there are many books dealing with just that. The question of how humans 'evolved' into what they are today involves many mysteries that nobody has been able to resolve satisfactorily. And natural selection doesn't work at all in the case of humans, except for genetic damage so bad that you die as a child or are sterile. Do smarter people reproduce more than stupid ones? No. Do fit people who exercise reproduce more than lazy, fat people? No.

So what can random mutation and natural selection really do? Let's have a look.

Can a wolf evolve into a dog or a fox? Probably. (If you can even call it evolving. I'd say it's just adaptation to environment.) They have the same skeletal structure, organs, fur, same number of legs etc. Only a change of sizes and colours would be needed. Simple mutations can do the job.

Can a wolf evolve into an eagle or an elephant? No. Randomness, one step at a time, doesn't create functional wings or tusks where there was no genetic code for them before.

What can a fish evolve into? Other fish.

What can a fish not evolve into? An eagle, an elephant, an ant, a human, a palm tree, or really anything that's not a fish.

We could say that micro-evolution works and macro-evolution doesn't.

To quickly recapitulate the various problems of Darwinism:

  • Origin of life inexplicable (more on this in part 3)
  • Sophisticated, functional, complex code cannot arise accidentally
  • Random processes are not creative
  • Most mutations have little to no impact on survival but degrade the code
  • Natural selection is powerless in most cases
  • Irreducible (or any decent) complexity can't be overcome by RM+NS
  • Deleterious mutations overpower beneficial ones thousands to one
  • The fossil record doesn't support the Darwinist model
  • Observations and experiments have only shown very simple adaptation and broken genes
  • Mutations induced by radiation don't result in any improvement, just damage
  • Similarity of structure is not evidence for evolution
  • Much "evidence" for evolution is known to be fake yet keeps being shown
  • The idea that given enough time, anything is possible, is a fallacy
How did we end up with a consensus theory that's so apparently wrong? I don't blame Darwin. I think he did a decent job with the tools he had. I think the problem came with a circle of people who saw that this theory was promoting a materialist world view which they already held, and so they decided to promote the theory, a bit too aggressively. By the time science started exposing the problems with the theory, these people had a lot invested in keeping it alive. The theory of evolution shifted from science to a dogma used to support the ideology of materialism and atheism. I couldn't care less if people want to be materialists and atheists, but when they use their views to distort science and obscure the truth, I do have an issue with it. This has set us back by decades, and possibly more if the course isn't corrected soon.

As science of the last half a century or so has shown, the combination of RM+NS has a very limited scope of action, and thus something else has to account for all the complexity of life that we see around us.

If neither Creationism nor Darwinism has the answers, then what does?

Creationism is a fairytale supported by a dubious book, and Darwinism is a zombie science full of wishful thinking, trying to keep alive something that has long since died. How, then, do we explain all this life around us? This is where we get into more speculative territory. You're free to draw your own conclusions, but I will offer some suggestions that may be worth considering.

One of them is the possibility that evolution somehow happens, at least to some extent, by other means than random mutation. Perry Marshall, in his book Evolution 2.0, proposes exactly that. Here's a part of his bullet point summary:

  • Neo-Darwinism says Random Mutation + Natural Selection + Time = Evolution.
  • Random mutation is noise. Noise destroys.
  • Cells rearrange DNA according to precise rules (Transposition).
  • Cells exchange DNA with other cells (Horizontal Gene Transfer).
  • Cells communicate with each other and edit their own genomes with incredibly sophisticated language.
  • Cells switch code on and off for themselves and their progeny (Epigenetics).
  • Cells merge and cooperate (Symbiogenesis).
  • Species 1 + Species 2 = New Species (Hybridization). We know organisms rapidly adapt because scientists produce new species in the lab every day.
  • Adaptive Mutation + Natural Selection + Time = Evolution 2.0.
All those things from Transposition to Hybridisation are processes that expand the information in the genetic code. They're not quite random, they exhibit signs of intelligence or purpose, and they produce more useful results than random mutation can. They've been known for decades at least, but Darwinists tend to ignore them, even though (or because?) they provide something more meaningful than randomness does. Marshall's book explains them all in detail. I won't go into that here, but it's clear that these are more useful evolutionary processes than randomness can ever aspire to be. Marshall calls the sum of these processes Adaptive Mutation, to distinguish it from random.

Darwinists stubbornly stick to their idea that 'randomness improves things and creates order'. They don't like God, and they apparently don't like any kind of intelligence either. Marshall gives an example of this avoidance:

quote big

In 2009, the famous atheist Richard Dawkins published his thick, best-selling book The Greatest Show on Earth. In it, he states that evolution is driven by random changes in genes. It is worth noting that in all of 450 pages of The Greatest Show on Earth

  • Symbiogenesis is never mentioned.
  • Horizontal Gene Transfer is briefly touched on once, downplayed and presented as scarcely ever crossing from one species to another.
  • Epigenetics gets one tiny footnote in chapter 8. He breezily shrugs it off as a "modest buzzword" and "confused theory that will enjoy 15 minutes of fame." (At the time of this writing, "Epigenetics" is a major focus in genomics and appears 129,000 times in Google Scholar. The number of entries has doubled in the last two years - clearly a hot field of research.)
  • Transposition is never mentioned.
  • Genome Duplication is never mentioned.

Why didn't Dawkins grant so much as three pages to the five best-documented mechanisms of evolution? Why does he act as though the last 50 years of microbiology and billions of dollars of research never happened? Oxford University's former "Professor of the Public Understanding of Science" wrote one of the most popular evolution books of the last decade, for which he received large advances and rode huge waves of media publicity.

So why isn't he disclosing this?" Because Dawkins has his own agenda, and after all these years, he's unlikely to change it. This book of his was supposed to explain why evolution is true. But throughout the book, instead of explaining the Theory of Evolution with some facts, he just mentions some facts and explains them with the Theory of Evolution. I don't think he understands much about facts, evidence, or objectivity. If you read his books, your knowledge of life and biology is likely to get worse because of all the misconceptions he proffers.

I don't know how much the Evolution 2.0 theory can really explain though. I don't think it can get us from fish to a tiger, and I'm not buying that it could have caused the Cambrian explosion. The simple reason is that if this is something that organisms have had at their disposal the whole time, there seems to be no explicable cause for using it a thousand times more within a certain relatively short era than in all the other eras. This is the same reason random mutations couldn't explain it either, even if they actually worked decently, which they don't. In fact, it doesn't seem like any natural process could explain the Cambrian explosion. The jump in perceived evolution there is so huge that there doesn't seem to be any way conditions could have changed so drastically that life could suddenly evolve on its own at a rate several orders of magnitude faster than ever, especially if almost all you had before that was on the level of bacteria.

To me, it looks more like somebody decided to step up the 'Life on Earth' experiment. But before we get to that, there's a more significant issue.

The Origin of Life

Darwin didn't concern himself with the origin of life. He simply acknowledged that life began somehow, and his concern was how it evolved from there. Neo-Darwinists, of course, had to do better than that to be taken seriously in the 20th century, but they haven't achieved that goal. If you want to know what happened 'at the beginning' and sort through the relevant literature, you'll find it frustrating because the answers simply aren't there. Lots of speculation, much of it quite silly, but nothing clear.

You'll find things like "the transition from non-living to living entities was not a single event, but a gradual process of increasing complexity". How does this make any sense? How do you get from non-life to life gradually? What are the intermediate stages? Something that isn't dead but not quite alive? Zombies? So much grasping at straws. In the end, after reading about many failed attempts at explaining how life came to be from non-life, you'll find that the simple and only true answer is that nobody has a clue. Anybody who tells you we know how life came to be from dead matter (or rather, 'nothing') is either lying to you or delusional.

There's the infamous Miller-Urey experiment that at one time was hailed as great progress because it was thought to show that some amino acids could arise spontaneously in nature, and it was presented as evidence for the creation of "the building blocks of life". The problem is that the phrase "building blocks of life" is misleading. Amino acids build proteins, and those are important in living organisms, but getting a few amino acids and claiming you've almost created life is akin to scribbling a few random symbols on a piece of paper and claiming you've almost created a language. When you have a few amino acids, you are nowhere near producing anything that even remotely resembles life. Just like when you have "if", "then", and "else", you're still nowhere near having a computer program, even if those three words may be considered the building blocks of software code. And even if the correct amino acids assembled in large numbers and correct order and formed a protein (a pure fantasy), then what? You have a protein, but without a fully functional cell, what can it do? Absolutely nothing.

Supposedly the first life was a bacterium. In order to reproduce, it needed DNA, various versions of RNA, some enzymes, ribosomes, etc. All of that is way too complex to be put together randomly. Even just DNA itself is too complex to be put together randomly, no matter how much time it takes. And you'd still need the other components to use the DNA. DNA is a code more sophisticated than any we have ever made, and there's absolutely no way in hell it came to be randomly. The only way we know of that a code can be created is if an intelligent mind designs it.

Marshall's comment on this is: "Origin of Life: Information theory says codes require a designer, or an undiscovered natural process that generates codes". If you discover a natural process that generates codes, you can win $5 million USD. Yes, this is something that Marshall is offering, and has been for a while. You can go to this link and read the requirements. If you discover how DNA could have arisen spontaneously, you'll get rich, and Darwinism may have a chance. Of course, nobody has yet claimed the prize, and no one is likely to since codes really do require a designer, because that's how all the codes we know came to be.

It's clear that something as sophisticated as DNA - an incomprehensibly immense database of manuals for complex structures and processes - had to be designed. Nobody has been able to offer any plausible alternative. Darwinists are trying hard, even desperately, but they're stuck at "we don't have a clue" (or stupidly insist that it was all an accident). As I've mentioned, a cell that can reproduce needs to be far more complex than just DNA itself. This kind of complexity requires design. Some people equate intelligent design with God, because apparently they lack both imagination and common sense. A car is a product of ID. The Internet is a product of ID. Were they made by God? So why would anybody think ID means God? I'm not sure which part of "intelligent" or "design" sounds like "God".

The properties of DNA tell us that it was most likely the product of design, and the designer must have been much smarter than we are. Who could it be, then? Well, whoever it is, clearly they're not hanging around to give us a chance to chat with them. But let's look at it from a different perspective. We ourselves have been messing with genetic engineering for a while. There isn't really much stopping us from seeding life on another planet, should we find one with favourable conditions. So, logistically, there's no reason why life on Earth couldn't have been seeded by somebody sort of like us. This is far more plausible than Creationist magic of 'God made stuff' and Darwinist magic of 'lol stuff just happens randomly'.

But if we were to seed life elsewhere, we'd have to use Earthly DNA, because we are nowhere near being able to actually create new life. Think about that; despite all our knowledge and intelligence and even though we have a basic understanding of how DNA works, we still can't design a code to create life. Despite this, Darwinists believe it happens all by itself, by 'accident'. But if somebody seeded life on Earth, they would likely have had the same DNA structure, which just shifts the issue of 'first origins' onto 'them' and doesn't explain the origin of DNA, but it would explain life on Earth.

However it happened, and whoever was responsible, it is clear that the immensely sophisticated code for life on Earth is a product of intelligent design of some kind. Just because we can't know the designer at this point, doesn't mean this inevitable conclusion is somehow less valid. And there's no reason to resort to God for the answer. To be fair, I also don't see any particular reason why there couldn't be something we might call God that created some life in the first place. There may be no evidence for it, but there is an equal lack of evidence against it, at least in theory. And remember, Darwinism is a theory!

As we get comfortable with the notion that the designer need not be God, it should be easier to understand any possible imperfections in the design. If we were to seed life on another planet, I'm sure there would be plenty of mistakes. Dawkins regularly mocks the ID theory in his books with questions like "who in their right mind would design this?" and "why would an intelligent designer design it this way?" Presumably Dawkins knows the biology of all creatures so perfectly that he knows how everything works and has worked in the past and can decide what's good and what's bad and he would design things better. Also he knows that design has to be perfect because, presumably, he has observed that humans have designed millions of things and all of them are absolutely perfect and without any flaws.

The last thing I want to mention here is consciousness. Darwinism, being a child of materialism, ignores consciousness as some kind of side-effect. This, in my opinion, is one of the biggest mistakes ever made in science. If you discard half of the Universe from your equations, how can you expect the output to make any sense? This is especially embarrassing since we've known for a long time from quantum mechanics that mind can affect matter. So the question we should probably be asking is: could consciousness affect DNA in some way? Could, for example, certain prolonged mental or emotional states turn genes on and off? Can there be some kind of tuning between the body and mind?

Of course we don't know anything for certain in this regard because, given the materialism that underpins modern science, nobody is doing that kind of research, but many people believe it's a legitimate line of inquiry. Materialism can't explain DNA and life, and Darwinism can't explain evolution, so it's worth considering what role consciousness might play. And if there is a role, it's likely to not be random and thus more likely to account for something constructive than random mutations can. The main point here is that if both Creationism and Darwinism/materialism fail to describe reality, we need to explore other options with an open mind.

Of course, if you believe that materialism is true, that everything is matter, and consciousness is just an illusion, then these ideas aren't for you. You are, by your own admission, a gene-programmed biological robot with no free will, no purpose, no values, and your life ultimately has no meaning. There's no point in discussing anything with such people, because any discussion is just an inevitable result of our genes, with a predetermined outcome and no meaning. (Yes, this is how stupid materialism is, so let's not waste any more time on it.)

The Big Picture

How does this all fit together?

DNA had to be designed. I'm open to other options, but unless somebody wins that $5 million for figuring out how the most sophisticated code we know could just accidentally self-assemble, I think design is the only answer that makes any sense. If there's a designer, then it's reasonable to assume life came here from the 'outside'. Then RM and NS kicked in and life started to adapt and diversify a little. Bear in mind that nothing complex "evolved" for 2 billion years. That was an era that's actually consistent with Darwinism.

During the Cambrian explosion, as far as I'm concerned, 'somebody' had to add more life forms (a lot more), because we don't know of any natural process that could reasonably explain this kind of quantum leap. 'Accident' is not a serious explanation. It is very likely that something like this happened repeatedly, with the times after large-scale disasters and extinction-level events being good candidates.

Aside from an unknown number of such interventions, life here is left to its own devices. This means the Darwinist process of RM+NS accounts for some of the adaptation, Adaptive Mutation described in Evolution 2.0 may account for some more, and if consciousness plays a role, which is hard to know because of the minimal attention given it by scientists, then consciousness may be responsible for some kind of evolution as well - possibly even more than the other mechanisms, for all we know.

For most of history, these natural processes were all that was going on. For all the 'missing links' and apparent quantum leaps, some kind of intelligent intervention from outside seems like the most probable explanation, since we have no scientifically plausible alternatives. The bottom line: functional complexity doesn't happen without some intelligence behind it.

We certainly don't have all the answers, and we may not find any in the near future, but we can move ourselves forward, in the right direction, by discarding ideas that contradict science. Random changes do not improve functionality. Ideology isn't science.

Recommended literature:

Michael J. Behe - Darwin's Black Box  (1996)
Michael J. Behe - The Edge of Evolution  (2008)
Michael J. Behe - Darwin Devolves  (2019)
Jonathan Wells - Icons of Evolution  (2002)
Perry Marshall - Evolution 2.0  (2015)
John Sanford - Genetic Entropy & the Mystery of the Genome  (2005)

Part 2 ♦ Evolution's Struggle with Complexity and New Genes  [Source]
flagellum

One of Darwin's famous quotes is:

quote big

If it could be demonstrated that any complex organ existed which could not possibly have been formed by numerous, successive, slight modifications, my theory would absolutely break down.

Such complex organs, not mentioning processes, exist in abundance, and they do absolutely break Darwin's theory down. His theory is about as broken as it gets, and this has been obvious for decades. Yet Darwinists refuse to accept it because they are more focused on maintaining their ideology and dogma than on the facts. In order to preserve the dogma, they usually ignore things that are inconvenient for them or misrepresent facts so that they can explain them away.

One of the many things that show the impossibility of organisms evolving step by step is the concept of Irreducible Complexity (IC). The point of the IC argument is that each part of a particular organ or process is necessary for the whole organ or process to work. If you take any one part away, the whole system stops functioning. It is not possible for parts of a system to be selected, step by step, when most of those steps do not produce a functional system. Several (or all of the) parts would have to evolve together, which contradicts the Darwinian model.

A well known example of such a structure is the bacterial flagellum, which you can see in the image at the top. Even just the fact that the simplest of organisms, a bacterium, possesses something this complex and sophisticated should give us pause. The flagellum is a marvel of engineering. It has about 40 parts that are all needed for the mechanism to work. It's similar to the structure of a man-made motor. You can probably guess that if you remove one part of a motor, it stops working. After all, if it worked without the part, why would the part be there in the first place?

Now imagine that the motor would have to 'evolve' one part at a time. It may be possible to assemble it one part at a time, but can you imagine that at every stage of the process you have something useful that works? In most of the stages, you'd just have a bunch of metal parts joined together but fairly useless because the thing can't perform any work. In the evolution of organisms along Darwinian lines, such stages are basically impossible. If a new addition isn't useful, or, to be precise, doesn't noticeably increase the organism's chances of survival, it won't spread in the population. Natural selection can't affect it.

One of the usual arguments of Evolutionists is that in the intermediate stages, the system or its parts can be useful for something else and thus improve survival. This is certainly possible in theory, but in practice, in 99% (or more) of all such cases, it would be extremely difficult at best to find any function for either the system or its parts. And if there was a function, there's a low probability that this system would later evolve into something with a different function. The logical direction of evolution would be to improve the function that exists. When a part is specialised in a certain way, any specialisation in a different direction would almost certainly decrease the quality of the original function. So while it is theoretically possible for this to happen now and then, it's untenable that it would happen in most, or all such cases, and when it comes to real life examples, proper explanations haven't been forthcoming.

If we look at the partially built motor, we see we may be able to use it as a hammer, for example. (And just about anything can be used as a paper weight, but how does that help us?) If we use this thing as a hammer, then an addition that will make it more useful is one that will make it a better hammer. But making it a better hammer is extremely unlikely to lead to a motor. And if the motor needs 50 parts, you have this problem at every single step. If at step 20, we have a hammer, and at step 21 a better hammer, how do you imagine we'll get to a step where the hammer stops being a hammer, evolves towards a motor but isn't a motor yet, and happens to have some other useful function? Suppositions of alternative functions are highly unrealistic and only reflect the desperate need to make evolution work at any cost. Requiring various different functions throughout the process actually makes the whole process far less likely.

There are certainly parts of the motor that can be used for other things, like screws. In the same way, biological structures can be made out of many things that, just like screws, are able to perform other functions. But you can probably see that the general usability of screws doesn't help us much with the intermediate stages of building a motor. Screws may be versatile, but it's the parts that are specific for a motor that are the core issue here.

A bicycle has many parts that can be useful for something else. Wheels can be used for many things, a saddle or seat exists on a horse or on the bus, a chain works in a chainsaw, brakes exist in a car, and so on. But how do any of those things help us 'evolve' a bicycle? They don't. Chainsaws don't 'evolve' into bicycles. They are separate designs. Usability of parts for other purposes doesn't help us evolve something specific.

toy

There can be functional subsystems, but that doesn't solve the problem. I'll use the toy in the image at right to illustrate this. Let's consider the eight coloured parts to be the building blocks of the system, and a state where it 'works' to be any state where there's balance between the two sides. You can consider this irreducibly complex in the sense that if we take away any one part, it stops working - we lose balance. But you can see that if we take the same part away from each side, we have balance, and the system works. This would be an irreducibly complex subsystem. To 'evolve' from this subsystem to the complete system, we need two steps, and we need them to occur at the same time.

This is important to understand because Darwinists sometimes point to such a functional subsystem with the claim that this defeats irreducible complexity. This is a fallacy, as I just explained, and moreover, their task should be not so much to disprove irreducible complexity, but to show that the system can actually evolve step by step. This means that they must account for every single step. Pointing out that there exists some kind of a middle stage that works is great, but it doesn't disprove the irreducible complexity of the complete system, and more importantly, it doesn't prove evolution step by step. The toy in the image has four functional states, but between each two of those functional stages there's a stage that's non-functional, making evolution step by step impossible. You cannot add one part at a time and have balance at each step. And biology is infinitely more intricate than this.

There has been an attempt to show that the flagellum (in the top image) could evolve step by step. But all that was shown was one intermediate stage that worked. (And it later turned out that the flagellum had existed first, which shows how desperate the evolutionary explanations are.) We can now understand that this doesn't prove anything other than that this one stage works. Trying to prove that something works step by step by showing that one particular step works is a dead end. Where is the evidence of evolution from nothing to that intermediate stage, and where is the evidence of evolution from that intermediate stage to the whole system? There isn't any. For evolution to work, all steps between all known stages would have to be explained, and as far as we can tell, several steps at a time would be required in many stages to retain functionality. Even if there's only one stage that requires several steps to show improvement, evolution towards a complex functional system, step by step, is impossible.

Irreducibly complex systems can be whole organs or just small macromolecules composed of several proteins. Living organisms abound with them. I don't want to go into too much detail here, but if you're interested in more examples of irreducible complexity in biological systems, you can check for example this blog post.

IC3
Try building this one step at a time

Darwinist evolution requires gradualness, and every step must give us some degree of functionality for natural selection to be able to keep the additions in the genome. But putting the flagellum together, just like putting a motor together, is not a matter of degrees of functionality. You need at least a significant collection of parts for any functionality to appear at all. If adding one part doesn't significantly improve functionality, natural selection can't make any use of it.

So the idea that any kind of complexity can be overcome gradually is nonsensical. Of course it's possible to evolve something that has only two or three parts if each stage can be shown to be useful. But three parts isn't exactly complex, and the probability of something like this happening decreases exponentially with every new step. If the probability of one beneficial mutation occurring is one in a million, then the probability of two that work together occurring is one in a trillion. Above roughly three steps, the probabilities are so low that they can't be taken seriously even with 3 billion years at our disposal.

coins
If you keep dropping four coins long
enough, sooner or later this will
happen! It has to, because evolution
wouldn't work otherwise.

Darwinists are convinced that accumulation of small steps will lead to creating complex structures, or to anything they want, but this is extrapolating beyond reason. Adding small, simple things just increases the amount of small, simple things. Accumulation of random words does not a sentence make. You can stick a bunch of words together randomly, but to get meaning, you need intelligence. Some relatively complex things might be assembled step by step, but most complex things need several additions at a time to improve, often many. Natural selection is actually a limiting factor here, because every step has to increase usefulness.

We can take Lego as an example. You can certainly build complex things out of Lego one step at a time. But the condition for natural selection is that after each addition, the thing you're building must be better (more functional) than it was before. For most of the Lego pieces, one of them won't make any difference for the overall usefulness of the whole thing. And for living organisms, it actually has to significantly increase survival rate, which is a lot more difficult than just being slightly better in theory. And I've talked about the serious limitations of natural selection in my first article on Darwinism.

Darwinists have this irrational idea that if you just give it enough time, anything is possible. But that's like believing that if I keep randomly throwing stones all my life (or for thousands or millions of years), I will eventually construct the Taj Mahal.

New Genes

One of the greatest obstacles to evolution is the need for new genes. There's a huge difference between mutating an existing gene and getting a new gene that will code for a new protein and will somehow have a control region on the DNA with instructions for the usage of the gene. If you want to evolve wings from nothing, you'll need a lot of new genes. Creating them randomly is virtually impossible. The idea that things can evolve gradually in very small steps ignores important biological realities. A new gene cannot evolve in small steps. You can't have half a gene. Either you have a whole working gene, or you have nothing.

The human genome has over 20,000 genes. To cover all species, present and past, evolution would have to have produced millions of new genes, yet evolving even one gene randomly is so ridiculously improbable that it's extremely unlikely it could happen during the 4.5 billion years of the existence of the Earth.

A new gene has to code for a new protein. This protein must have at least about 70 amino acids to be able to fold. If it doesn't fold, it's useless. Douglas Axe did experiments to find out what percentage of all possible proteins will fold. For a small protein of 150 amino acids, he calculated that only 1 in about 1074 amino acid variations would fold. So the very vast majority of proteins produced randomly would be completely useless. Finding one that works would be virtually impossible, even given an infinite amount of time.

Many proteins are thousands of amino acids long, requiring genes of specific sequences up to 100,000 nucleotides long to be created randomly. These lengths make the problem many orders of magnitude worse, and for most tasks in the organism, many proteins need to work together, which again compounds the difficulty. Consider that the task of protein translation requires over 100 proteins to do the job! Replicating the DNA requires over 30 proteins, the main one being longer than 1000 amino acids. They all have to be very specific and they have to fold in specific ways, so "evolving" them step by step is pretty much impossible. You need at least 70 amino acids to start with, and once the protein folds and performs a function, changing it to a longer one that performs better or does something else would be at least as difficult as creating a new one.

When Darwinists suggest how something like an eye could have evolved, they completely ignore biology. They think that mutations can just give them whatever they want, in small steps, and they only focus on the result (morphology), disregarding the processes required (molecular biology). They say the eye started with a light sensitive patch, as if that's a small step. It's not. It requires cells different to any that the organism has had so far, which requires at least one new gene, likely more. Yet this is completely ignored. And once you get to another new part, like a lens, you need new genes again. As David Swift writes:

quote big

It really is time that biologists stopped proposing evolutionary scenarios that completely ignore genetic and biochemical implications. They have got to be taken seriously. A blind faith in the power of opportunistic genetic variability just will not do.

Swift has much more to say about the difficulty of producing new genes by chance on his website, which is an excellent online resource for information about the problems of Darwinism in general.

While genes themselves are an insurmountable obstacle, you need not only a new gene, but also a control region that regulates how this gene is used. A gene without a control region is about as useful as buying a car and being told that the car is parked somewhere on this planet but no one knows where. Both the gene and the control region must be very specific and must arise at about the same time. How can this happen?

Darwinists say that the major source of new genes is gene duplication. Let's be honest - it's the only source they have, and it's a rather bad one. The idea is that a gene or a whole chromosome (or the whole genome) gets duplicated, and while one copy performs the old function, the other one can mutate and ultimately start performing a different function. This sounds plausible on the face of it, but how realistic is it really when we rely on biology rather than magic? Not very.

The idea that it will work as imagined is extremely naive. Let me relay a few quotes from the book Genetic Entropy by John Sanford:

quote big

Let us consider the human population. Are there any polyploid humans? Of course not. Duplicating all the human genome is absolutely lethal. Are there any aneuploid humans? Yes there are-a significant number of people have one extra copy of one chromosome. Do these individuals have more information? Most emphatically they do not. While aneuploidy is entirely lethal for larger chromosomes, an extra copy of the smallest human chromosomes is not always lethal. Tragically, the individuals who have this type of "extra information" display severe genetic abnormalities. The most common example of this is Down's Syndrome, which results from an extra copy of chromosome 21. There are countless smaller duplications and insertions which also have been shown to cause genetic disease.

[…]

It is often claimed that after a gene duplication one gene copy might then stay unchanged while the other might be free to evolve a new function. But neither of these events is actually feasible. Both copies will degenerate at approximately equal rates due to the accumulation of near-neutrals [near-neutral mutations]…

[…]

The simple-minded notion that merely duplicating a gene might be beneficial is biologically naive.

[…]

Lastly, actual gene duplications not only mess up their own expression, they routinely mess up the expression of other genes. Much of my own career was spent in the production of genetically engineered plants. Industry and academia spent over a billion dollars in this endeavor. What was quickly discovered was that multiple gene insertions consistently gave lower levels of expression than single gene insertions. Furthermore, the multiple insertions were consistently less stable in their expression …

Even in the best-case scenario, where nothing gets completely broken right away, there's hardly any potential for improvement. When you duplicate a gene, the production of the associated protein will increase. But because organisms are quite finely tuned, this increase is far more likely to be detrimental than beneficial. But suppose it's neutral. What then? Naturally, mutations make genes degenerate, and it's natural selection that prevents this from happening too severely. But because there are two copies, degeneration of one of them poses no problem for survival, so it can degrade rather quickly into a useless pseudogene.

The idea that mutations will cause a change in the resulting protein that will be beneficial is, again, pure fantasy. Changing even one amino acid in the sequence is more likely to prevent the protein from folding (and thus become useless if not detrimental) than do anything else. It would be extremely difficult to get a protein that works at all, much less one that's somehow better. And the chance that it would evolve into a longer functional protein is essentially nil. We're dealing here with probabilities of one in 101000 and worse. And these odds would have to be overcome millions of times for evolution to be true. In his book Signature in the Cell, Stephen Meyer explains in detail many of the relevant calculations. Even with the power of the whole Universe and 13.8 billion years available, the probability of creating a functional protein by chance is nil.

Let us note what the observed reality is. We have seen adaptation by mutations in nature and in labs. But virtually every such example is a mutation of an existing gene. The same is, of course, true of dog breeding. Even if humans help the process, there's no way to get new genes, so any results arise from the present variations. The Darwinist model works for adaptation by modifying the existing information, i.e. the present genes. No new genes are created by random mutations, thus natural selection cannot preserve them. They simply don't exist.

It is time to accept that random mutations and natural selection only have a very limited scope, and for anything complex that requires new genes, something else must be at work.

Part 3 ♦ Evolution - A Modern Fairy Tale  [Source]
evolve

Evolution is an amazing thing. It consists of a vast number of strange events that have almost zero probability of happening. It is so unbelievable that nobody would take it seriously except for the fact that EvolutionIsTrue™.

EvolutionIsTrue™ is a mechanism that has evolved over about 100-150 years. Once there was this bloke named Charlie Darwin, and he imagined that living creatures evolved from one another, and he wrote a very boring book about it. He didn't really have a clue how it would work, because science kinda sucked back then. Many people said he was bonkers, but others took him seriously. Several decades later, science stopped sucking so much, and it became obvious that this evolution thing couldn't work. But some people liked Charlie's idea so much that, instead of disposing of it safely, they decided to promote it even more, despite the evidence. That was the foundation for EvolutionIsTrue™.

But there were still people who kept pointing out that evolution is nonsense, and this really annoyed the Darwin fan club. So over the next 50 years or so, they attacked and ridiculed the opposition and all but outlawed any criticism of evolution. Evolution was 'proved science' because they said so, despite all the proof against it, and they gained so much power that they were able to finally proclaim with utmost authority that EvolutionIsTrue™ and questioning it is not allowed.

This was a smart move, because now not only could any remaining dissent be easily dismissed, but so could any evidence against evolution, simply because of the fact that EvolutionIsTrue™. Code cannot self-assemble? Surely it must have, because EvolutionIsTrue™. Making new proteins by chance is impossible? It must be possible because EvolutionIsTrue™. Common ancestry is disproved by differences in embryonic stages? No sir! EvolutionIsTrue™! Problem solved.

dnarep
Boil a primordial soup for about
a million years, and you will surely
get something like this going on.

I will now tell you the story of evolution, because some people aren't sufficiently familiar with it. This is the official version, written in a simple language that anybody can understand. Here's how it happened...

Long ago, there was no life on Earth. There was only this thing called Primordial Soup (at least according to a few people), which had magical properties because it could create life out of random atoms. Atoms randomly joined to make molecules, and for a long time, the resulting chemicals were just hanging around. But then, somehow - nobody knows how - these chemicals, instead of naturally degrading, accidentally assembled into something so complex that even today we cannot make anything so sophisticated. We are just not as smart as random processes in a magical soup.

Now brace yourself, because this part may be difficult to accept because it's so unbelievable, but remember, EvolutionIsTrue™, so it must have happened, somehow. The first living cell appeared! Just out of the blue, or whatever colour was prevalent back then. And this cell could replicate and thus create more cells. To do this, it needed a lot of things. It needed DNA with at least tens of thousands of nucleotides. Nucleotides are simple chemicals that join together to form a helix. They don't normally just do that on their own, but they did in the magical soup. So many thousands of them randomly joined together, with no aim and for no reason, and then there was DNA.

That in itself may seem utterly amazing, but only until you learn that this random sequence of nucleotides apparently wasn't so random after all. It was in fact very specific, because it coded for functional proteins! Lots of them. Randomly coding for functional proteins is something so improbable that no rational person would seriously entertain such a thought, but rational people are in short supply these days, and besides, EvolutionIsTrue™, so it happened. If you don't know how improbable it is to randomly code for functional proteins, you can read this, but I will tell you the chances to make the right protein randomly are about one in 1077 for a chain of only 150 amino acids. That's literally worse than a snowball's chance in Hell! Even if all the atoms on Earth were doing nothing else than trying to make proteins, they would be very unlikely to make even one during the few billion years of Earth's existence. And many essential proteins are over 1000 amino acids long, and usually several proteins need to work together to accomplish anything. Now that's amazing, some might even say incredible, or unbelievable.

The really funny thing is that proteins are needed to read DNA, and DNA must be read in order to make proteins. You may think that this would make cell replication impossible to start, but worry not! EvolutionIsTrue™. We have no clue how the first cell could be created, but we know it was, so it's all good. Someone will figure out the details later. However it happened, there was now a cell with DNA with a super-sophisticated code that could make proteins and could replicate itself. And all these things came to be one step at a time. Many such things occurring at once is so improbable that even evolutionists consider it impossible. And these are the guys who are in the business of regularly overcoming the impossible (in their imagination, at least). So one step at a time, for hundreds of thousands of such steps, the first cell somehow formed with everything necessary to self-replicate and presumably do some other things like move around. Considering that proteins degrade within a day or two and RNA degrades within a few minutes, this is very impressive! How could it be? Magic? No, just... well, actually, yes, it's more or less magic since there's no accepted scientific theory for this. But we know it happened because we are here and EvolutionIsTrue™!

bactohuman
Whenever you have to choose
between accident and intelligence,
you should always pick accident.

So now there were all these bacteria swimming in the ocean with their ridiculously complex flagella that evolved randomly one step at a time, even though nobody has a clue what those steps could be. At some point, viruses also appeared. Nobody really knows how. Some say they appeared even before bacteria. Others say it's nonsense because they need a host. Some believe viruses have evolved from DNA or RNA that had escaped from bacteria. Others say that's nonsense because viruses contain structures never seen in bacteria. Some people believe some other things and other people believe those are nonsense as well, so virologists are trying to figure out a theory that isn't complete nonsense. It will probably take a while, but in the meantime, you may be consoled by the fact that EvolutionIsTrue™, so this isn't really a problem.

For 2-3 billion years, evolution was randomly slow, bacteria were still bacteria, viruses were still viruses, and not much happened. They were all just lying in wait, preparing to accidentally explode into dinosaurs, even though they didn't know it. When the Cambrian Period arrived, evolution sped up about a million times, for no apparent reason. In roughly 20 million years, most animal phyla appeared, with many subgroups. This was kind of like evolution on steroids, but we don't talk about that because evolution is supposed to be gradual and the Cambrian Period is really inconvenient. Why are intermediate stages conspicuously missing? We don't know. We can safely ignore it, though, because EvolutionIsTrue™, and that's all that matters.

There was a bit of evolution going on before that, mainly in the Ediacaran Period, but strangely enough, most of the life forms of that time went extinct during the Cambrian Period. Evolution is random. Sometimes you evolve, sometimes you die. The Ediacaran creatures were weird, and we don't even know whether they were animals or lichens or algae or fungi or something else, so it's just as well that they disappeared. Good riddance, freaks.

How did single-celled organisms evolve into multi-celled ones? There are three hypotheses for that, which means that nobody knows. Future generations can figure it out, if they want, but it's not necessary because EvolutionIsTrue™. We already have all the answers we really need, so scientists can take it easy.

How is it possible that so many disparate life forms suddenly evolved so quickly from bacteria that had been just boringly swimming around for 3 billion years? Nobody knows. Some say that it isn't possible, but those people must be silenced, because EvolutionIsTrue™.

Millions of new genes must have randomly appeared, which is interesting, because it's really difficult to make new genes and there's hardly any evidence of this ever happening. And these genes would have to accidentally code for millions of new proteins, which, as we have seen, is completely ridiculous. The chance of getting a protein of 150 amino acids that will fold (out of all possible combinations) is one in 1074. There are about 1068 atoms in our galaxy. So you have a better chance picking a specific atom in our galaxy blindfolded than randomly making a 150-amino-acid chain that will fold at all, never mind be useful. And there are proteins containing up to tens of thousands of amino acids! The chances of randomly making those are probably about one in 1042186 or so. I'm not sure exactly because when I tried to feed my calculator numbers this ridiculous, it exploded. But it's kind of like flipping 100,000 coins and getting all heads. Good luck with that. But millions of new genes must have arisen randomly and must have accidentally coded for millions of virtually impossible proteins. Can you believe that? I certainly can't, but it must have happened, because EvolutionIsTrue™.

As things went on, we got some new cool things like birds and lots of plants, though lots of other cool things went extinct. The original bacteria randomly mutated into so many diverse and completely improbable things that you would almost think they had to be designed. But you can't! Why would you even suggest such heresy?! EvolutionIsTrue™! We don't need no intelligence here, okay? Just let things be, and everything will slowly improve, smashing through entropy like a boss.

Now, as you may know, birds randomly evolved wings. Their predecessors' arms accidentally mutated into wings one step at a time. Those were dinosaurs, by the way. Dinosaurs with 12% of their arms turning into wings totally outperformed dinosaurs with 11% of their arms turning into wings, so natural selection killed off the 11-percenters. And so it went with each 1% increase until their wings were 100% complete. That's how evolution works. No doubt about that.

gira

Many interesting things were happening everywhere. Kangaroos randomly evolved pockets for no reason, but they sure came in handy for carrying their young. Talk about luck! Deer randomly evolved antlers, goats randomly evolved horns, turtles and snails accidentally evolved shelters to hide in, zebras and tigers randomly evolved stripes, plants evolved photosynthesis (which may seem really smart, but it was an accident), dinosaurs-soon-to-be-birds randomly mutated their mouths with teeth into beaks, porcupines accidentally evolved quills, cactuses randomly evolved spines, some snakes randomly made new genes that accidentally coded for new proteins that happened to produce various kinds of venom, which turned out to be unexpectedly helpful, flytraps randomly evolved fly traps, ants randomly evolved a complex social structure, octopuses randomly evolved tentacles from whatever they had before, some planthoppers randomly evolved gears, one cog at a time, whales randomly evolved singing, spiders accidentally learned to make webs out of a material that randomly popped out of their bodies, and pandas randomly evolved cool make-up. The platypus accidentally evolved features of ducks, beavers and otters all mixed together. (To be fair, that really does look like an accident.) Giraffes randomly evolved huge hearts, some valves, constricting blood vessels and other useful things that miraculously saved them from blowing their brains out every time they tried to drink.

There was never any intelligence involved in any of it. Everything was completely random, so any creature could have evolved anything or into anything. Check the image at the top of the page to see what we've missed.

Towards the end of this story, in a really funny accident, humans evolved a sense of humour. (At least some of them.) This was only possible because somewhere along the way, something accidentally evolved consciousness. We don't quite know what this consciousness really is and when it first appeared and why, but some people insist it exists, so if it exists, it must have randomly evolved. There's really no other way anything can happen.

Recently, humans evolved an affinity for destroying their own environment. This may seem rather strange, because genes are supposed to push every creature towards survival, and destroying one's own environment is rather suicidal, but there must be a good reason for this because EvolutionIsTrue™. If the almighty natural selection selected for it, then it must be good for survival. In a series of much less controversial events, humans have driven many other species towards extinction. This is called survival of the fittest, and humans are the fittest. They are about to show everyone their evolutionary superiority by exterminating everything else and then starve to death (possibly after a short period of rampant cannibalism) because there will be nothing else left to do (or eat). And perhaps that was the point of evolution all along. Who knows? It's all random anyway, so don't worry about it!

The End.

Part 4 ♦ The Probability of Evolution  [Source]
70s ribo
A ribosome. It might seem like a jumble,
but if it's arranged in any other sequence,
it wouldn't be a ribosome

How does evolution happen? By chance, we're told. Stuff just happens. Every step in evolution is an accident. The model we're all taught at school says that evolution happens through random mutations and natural selection. Natural selection is supposed to sort the good from the bad, so the only mechanism that produces any "new" information is mutation. This mutation amounts to random errors in DNA. (Yes, this may already sound bizarre, but that's the theory. You are the result of billions of years of accumulated errors. You were a bacterium back when you were flawless.) If these errors happen to be "helpful" (also a slightly bizarre concept), the organism survives and reproduces better than others, and passes the new genetic information on. As we know, most mutations are detrimental. The beneficial ones are rare. So if evolution happens only by chance and the good mutations are rare, we should ask ourselves, just how probable is evolution?

The thing obvious to most mathematicians (these are the people who actually understand probability) who have ever considered this question is that it's not probable at all. In fact, it's extremely improbable, and they've been raising this issue since the 1960s. Mathematicians find it hard to take this theory seriously, because they can do the math. Neo-Darwinists, on the other hand, are not so good at doing the math and insist that, while everything about evolution indeed is improbable, given enough time, this improbability can be overcome. But is that true? Can this improbability really be overcome by time? As we will see, it can not. The idea that it can is rooted in a strong conviction that it must, wrapped in hazy assumptions devoid of any connection to real world data, and thus it is a delusion. Real world data paint a different picture. It's one thing to vaguely acknowledge something is improbable. It's a whole different thing to do the calculations and see just how crushing the improbability is.

I've been over the basics of evolution in my previous articles, but let's quickly recapitulate. The genetic information in the DNA is encoded in a long string of sequences of four letters - A, T, C, G. So it looks like 'TACGATGCTAGCAT...' and so on. What mutations do is they randomly change some of these letters. These sequences are then used as a template to code for proteins. Different sequence -> different protein. That is, if you're super-extremely lucky. If you're not, then it's different sequence -> nothing. You'd just get a polypeptide that won't fold and is thus useless. If you're still somewhat lucky, it gets cleared away by the sophisticated machinery in the cell. If not, these failed products can accumulate, stick together, and cause diseases. Mutations are pretty destructive. Everyone (except Darwinists) knows that.

Evolution is something that supposedly improves things over time. But the only thing that, according to the theory, provides new information is literally 'random errors' in something that worked in the first place. It shouldn't take a genius to acquire a vague suspicion that this sounds rather improbable, to say the least.

This article will contain a lot of numbers, but for those not mathematically inclined, here's a good simple analogy. Imagine you have a book - say, the Bible. I know, terrible example of a book, but don't worry - we'll mutate it into something better. Now imagine we're in the old days before printing, and books are copied by hand. They're copied by people who aren't perfect and make mistakes sometimes, and who often don't understand the language of the book. So every now and then, there's a missing letter or word, or words are misspelled, and so on. Let's say this process goes on for millions of years, until the text has little resemblance to the original book.

With the genetic code, the idea is that a fish started mutating hundreds of millions of years ago, and after all that time, ended up becoming a monkey. To understand how laughable this idea is, imagine that the Bible that's being copied countless times slowly becomes a different book, like The Lord of the Rings. Wouldn't that be amazing? Sure would, but even if your mathematical skills are inferior, you can easily figure out that this is never going to happen. To get The Lord of the Rings, somebody has to deliberately and consciously write it. The story has to be planned, and every letter in the book has to be quite specific. It's never going to arise from random copying errors. Noah is not going to become Frodo by accident, much less by a series of thousands of small steps. (Though it would certainly be fun to imagine all the intermediate stages... "Thou shalt bring two animals of each species to Mordor!") And yet, we're supposed to believe that exactly that kind of thing happened between the fish and the monkey. Anybody smell a rat yet?

The Origin of Life

Maybe the greatest problem for the whole Darwinian game of "there is absolutely no intelligence involved in producing life" is the question of how life originated in the first place. It's not strictly a matter of evolution, but it's closely related. One thing the Darwinists absolutely insist on is that there can be no designer. (Design really freaks them out, for some reason.) If there was a designer for the first living cell, then there would be little point in insisting that no design is involved in evolution itself, so Darwinists must also insist that even the first cell arose only out of some natural processes, with no intelligence involved. They have no idea how it would happen and have been arguing about it for decades, but they all agree that no intelligence could possibly have been involved (because intelligence is scary). This is rather ridiculous, since all evidence so far has shown that no unintelligent processes can account for creating even a fragment of a living cell, but these scientists, convinced that materialism must be true, refuse to give up on their unworkable theory and accept reality.

The general idea then is that the first living cell arose through natural processes, simply by means of the laws of physics and chance. But all such theories have failed to convince more than a handful of people, and for good reason - like, for example, that they make no sense. Let's look at what such a cell would need in order to function and reproduce.

Most of the smallest bacteria have hundreds of thousands of nucleotides in their DNA and code for hundreds of proteins. The smallest bacterium I could find is Carsonella ruddi, with 160,000 base pairs, coding for 182 proteins. And this is only because some of the functions necessary for its life are performed by its insect host (so it could never be the first cell, as it cannot survive on its own). In terms of producing this by chance, though, this is still huge. There has to be a specific sequence of 160,000 letters that codes for 182 very specific sequences of amino acids. Imagine typing 160,000 random letters blindfolded on a keyboard with mixed-up letters. How much of the result do you think would be useful in any way? Would it produce at least one sentence? How about a book? Or an instruction manual for building a robot? (Preferably one that can duplicate itself.)

To give another simple analogy, let's consider the proverbial needle in a haystack. If you think it's hard to find a needle in a haystack, then allow me to inform you that you would sooner find a trillion separate needles in a trillion separate haystacks than produce a single protein by chance. Randomly creating the DNA of a small living cell would be like typing 160,000 random characters and ending up with a functional computer program. As a matter of fact, I have written many scripts in two programming languages. I have one that has over 150,000 characters, so this is a good comparison. I can tell you it was a lot of work to write it and required lots of thinking, planning, and many hours of testing and debugging. Now, for most of the characters in this script, if you changed the character to anything else, at least one function of the script would break, and possibly the whole thing. There are actually many ways of breaking the whole script just by one typo. So it takes lots of effort and planning to make something this complex work at all. The idea that it could be written by random typing wouldn't be taken seriously by anyone.

So why is anyone taking seriously the idea of a cell arising by chance, when we've never seen anything even remotely similar happen? This idea just doesn't reflect our experience with the real world at all. What we've seen in the example of my script is that all the information is very specific. Specificity is by definition basically the opposite of randomness. So how can randomness create specificity? It seems like the worst possible candidate for the job. It's like expecting gravity to cause flying, or falling into mud to make you cleaner.

ecoli ribo
The structure of the RNA for the large
ribosomal subunit in E. Coli. (About
3000 nucleotides.) The ribosome
also has a small RNA sub unit
(~1500 nt) and about 50 proteins.
A happy accident?

But things are much more complicated than just getting the right sequence of nucleotides. Once a living cell is complete, things may go smoothly from there in terms of reproducing, but assembling the first cell without a parent cell is infinitely more difficult. Let's say we somehow got the DNA with all the code for all proteins. What now? Well, now nothing. We need 12 proteins to transcribe DNA to RNA before we can make any proteins. And to make the proteins from RNA, we need 106 proteins to do the job. We need functional ribosomes, which, aside from containing about 50 of those 106 proteins, also need several thousand nucleotides worth of RNA, all very specific. (See top image to appreciate the complexity of a ribosome.) We need twenty different aminoacyl-tRNA synthetases - enzymes of hundreds of amino acids each - to assign correct amino acids to 20 different types of tRNA molecules. (This is more or less what determines the genetic 'code'.) So you see the problem here. We need a DNA blueprint for all the required proteins and RNA, but over a hundred of those proteins and a lot of the RNA are needed to read the blueprint and make proteins. It's the chicken-and-egg problem, on steroids. For life to start accidentally, there would have to be more than a hundred complex things, each of them highly improbable to ever arise by chance, all appearing at about the same time.

There are numerous difficulties with this scenario, other than just needing hundreds of thousands of things to connect together in the right sequence by chance. For example, there's chirality. Amino acids come in left-handed and right-handed forms (mirror images of one another), which occur with about the same frequency. Yet for a functional protein, all the amino acids must have the same chirality. And not only that. In fact, all proteins in living organisms consist strictly of the left-handed versions of amino acids. How random does that sound to you?

So for a protein to form, not only do you need, say, 200 amino acids in a precise order, but also with the same chirality. The chances of just getting the chirality right are like flipping 200 coins and getting all heads or all tails (about one in 1060, in this case). The same problem also exists in the DNA and its sugar deoxyribose. The sugar also comes in both forms, and for DNA to work, it again needs everything to have the same chirality. Also, one side of the DNA ladder has the deoxyribose rotated by 180 degrees in relation to that of the other side. In other words, the two strands always run in opposite directions. So again, if the process of assembly is random, how come the result is so specific?

On top of that, the amino acids in proteins need to form peptide bonds. When they react naturally, they form peptide and non-peptide bonds with about the same incidence. Once the wrong bond is formed, random processes have no way of fixing it. So every amino acid has a 5% chance of being the right one (there are 20 amino acids), a 50% chance of having the right chirality, and a 50% chance of forming a peptide bond, but hundreds of them have to assemble in the right order, have the right chirality, form the right bond, and the first cell would need a few hundred of these proteins, at least. So making just one is akin to picking 200 people, randomly, and ending up with all women, all left-handed, all between the ages of 36-40, and lined up in the alphabetical order of their last names.

The cell also needs a very specific membrane that's smart about what can or cannot go in and out of the cell, which is no easy task, but it's absolutely necessary for the cell to function and survive. (A whole chapter could be written about the cell membrane, its complexity, and its numerous amazing properties.) And that's still far from being all the problems with this scenario. If the process is supposed to happen slowly, over a long period of time, then there's the issue that things degrade far faster than they can assemble. Proteins are stable for up to a day or two in a cell, and RNA degrades within minutes. How, then, is this supposed to happen slowly over millions of years? Try to cook your dinner slowly, over about 100 days, when many ingredients get spoiled in a day or two. Or try to create a slow explosion that lasts about 3 hours. Things simply don't work like that.

membrane
Cellular membrane. Probability
of occurring randomly: 0.

Most things tend to react with other things we need them not to react with, rather than with the ones we need them to. Everything has a stronger tendency to break than to build, which is logical if the second law of thermodynamics is true. Some reactions require energy, which is provided by the complex machinery in the cell, but here, we don't have a cell yet. We're trying to build one.

There are actually several separate problems that all need to be solved for a living cell to arise.

  1. Chemicals must assemble in completely improbable ways, creating DNA and proteins
  2. Something must determine the code, i.e. which codons code for which amino acids
  3. Random sequences must produce functional proteins
  4. Proteins & RNA must do specific jobs
  5. All these jobs together must create a single functioning organism

This is ridiculously implausible. Each of these problems alone would be extremely unlikely to ever be solved.

  1. Chemicals don't naturally assemble to form DNA or proteins. Problems include reactivity with wrong chemicals, chirality, type of bonds, degradation, energy requirements, etc.
  2. The genetic code requires 20 different aminoacyl-tRNA synthetases, each made of hundreds of amino acids. This would be difficult to invent, so expecting it to occur randomly is just stupid. It's like expecting a programming language to occur randomly. When these 20 enzymes first appeared, there was supposedly exactly zero intelligence around and no idea of a code. It's difficult to create a code when you're trying to create a code. It's impossible when you're not trying. Nobody has a damn clue how the genetic code came to be. Most evolutionists won't even touch this problem.
  3. Randomness doesn't create order, specificity, complexity, functionality, or anything like that. The idea that a ribosome, made of thousands of nucleotides of RNA and dozens of proteins, which happens to somehow know how to make proteins out of RNA, just kind of 'happened' is so far into the realm of fantasy that one has to be properly brainwashed to not notice how idiotic it is in the real world.
  4. Try making a tool that will perform a specific job without having a clue what the job would be. It makes no sense. If a protein were to be made accidentally, which in itself is pretty much impossible, nothing in the cell would know what to do with it. If a ribosome was somehow accidentally made (fat chance), how would anything know that it can translate RNA into proteins? How would anything know to give it the RNA (or to transcribe it in the first place) when no protein translation existed before that? What would prepare all the tRNA stuff for the ribosome to work with? What would know where to transport the finished proteins and what to do with them when no proteins had ever been made before? I mean, if you gave a caveman a microwave oven, what use would it be? At best it would become a neat table. Just like the caveman would need to know what it is, what it does, what to put inside, and how to supply electricity, the cell needs to know the ribosome can translate RNA, uses tRNA with amino acids attached by the tRNA synthetases, and makes proteins, and it needs to know where to take the proteins and how to use them. How do Darwinists deal with such problems? They don't. They just ignore them.
  5. This is never even considered. How are the thousands of things happening in a cell coordinated to produce 'life' with zero intelligence behind it? You can put 20 sophisticated machines in a room, but when there's no intelligence involved and the machines were put there accidentally, there won't be much going on. The coordinated cooperation of everything in the cell is mind-boggling. The stupidity of ascribing that to accident is even more so.

All attempts at solving this puzzle have only lead to shunting the problems from one place to another. For example the 'RNA world' hypothesis suggests that RNA was first and DNA and proteins came later. But there's no viable way this could work, and it doesn't get rid of almost any of the problems outlined above. Stable RNA that lasts more than several hours exists only in fantasy. Self-replicating RNA exists only in fantasy. RNA 'evolving' into DNA exists only in fantasy. None of this stuff has ever existed even with scientists doing their best to make it happen in a lab, much less randomly in nature.

This sort of ridiculous theory only exists because somebody starts with "We must have a theory for life arising randomly because our belief in materialism is unshakeable" and they're willing to ignore countless problems for a faint chance that one of these idiotic ideas might work. They don't. There's no solution in sight and never will be under a materialist flag. "Stuff happened randomly because materialism is true" is just as retarded as "God did everything because the Bible says so". Both ideas are based on faith and not science. If we ever want to get real answers, this sort of stupidity has to stop.

See here for more on the problems with the origin of life.

Evolution

enzyme
A folded protein. Each ball is one
amino acid. The active site has to
contain the correct ones in
a correct configuration in order
to perform the right job.

Ignoring the origin problem, we still need to get from bacteria to everything else. How likely is that? We have to distinguish between two things - small mutations that lead to adaptation, and making new genes, which would lead to the big changes that are necessary to create different species, genera, and higher up. We can call these micro-evolution and macro-evolution. It is rather incomprehensible how most evolutionists completely fail to distinguish between the two. How significant is the difference? Well, simple adaptation is about as easy as learning to ride a bike. Creating new genes is about as easy as a squirrel writing a scientific article accidentally. We're still waiting for that one to happen. Yet we see people like Richard Dawkins regularly claim that just accumulating small changes will do the trick, completely ignoring the issue of new genes (along with other things - like, you know, common sense).

Without new genes, bacteria would forever remain bacteria. No new species, no new organs, no evolution. New genes are essential for anything significant to happen. A gene is a section of DNA that codes for a protein. So it's really about getting new proteins. The gene is the instruction manual. (You can think of it as a sequence of 1s and 0s [the gene] translating into an mp3 file [the protein].) The reason we cannot get a new protein step by step is the high specificity it requires for functioning. Among other things, a protein has to fold correctly. If it folds incorrectly, or not at all, it can't do any work. What makes it fold correctly? Well, for starters, it needs to be at least about 70 amino acids long, or it doesn't fold at all. So it's ridiculous to state that it can evolve one little step at a time. It can't. One amino acid requires three nucleotides to code for it, so 70 amino acids means a sequence of 210 nucleotides in the DNA. So the smallest step here is to get a sequence of about 200 letters accidentally that will code for something very specific, which is really not small at all. You can try typing 200 letters randomly and see how often that will produce sentences or computer code. (Presumably, though, it's easy after that. You just randomly add more characters slowly, one at a time, until you end up writing either a sequel to Hamlet or Windows 25. Either one is acceptable.)

But that's not all, of course. The gene also needs a control sequence that regulates when and where to make the protein, so there has to be another specific chunk of DNA that does that. A gene without a control sequence is useless, and a control sequence without a gene is useless. If one appears without the other, it will degrade by deleterious mutations, which occur rather frequently. (And in fact, the mutations will pile up faster than usual because natural selection has no reason to eliminate them, since the whole thing isn't doing anything yet. If you think about it, the destruction is happening even before the new gene is complete so, in fact, the construction will never finish in the first place.) So the gene and the control sequence would both have to appear at about the same time.

Even just the chance of these two things appearing synchronously (assuming wrongly that neither one of them is difficult on its own) is really low. It's like accidentally making a new component for a computer and at the same time accidentally writing drivers for the use of this component. Imagine you're sitting at work and suddenly say, "Oh, I just built something. I don't know what it is, but it looks like maybe it could go into a computer." And your colleague says, "Oh, really? I just wrote some code here. I don't know what it's for, but it looks like maybe it could work as drivers for something. Let's see if it works together with your thing." And then, of course, it works. Computer evolution right before your very eyes.

But back to reality. Remember that nothing in the organism is supposed to have any clue what to do with the new gene, should one 'arise'. We need two very improbable accidents that perfectly match one another. That in itself is a ridiculous requirement for random mutations to ever fulfill. But that's just the tip of the iceberg.

One of the most crucial questions in regard to the probability of evolution is: What are the chances of randomly creating a nucleotide sequence that will produce a chain of amino acids that will fold into a protein able to perform a job? Douglas Axe spent a lot of time figuring out the answer. According to his research, for a sequence of 150 amino acids, only one such sequence out of 1074 would fold. One out of 1077 (1 with 77 zeros) possible sequences will be able to do the required job. The number of atoms in the whole universe is estimated to be about 1078-1082, so this is close. To imagine what this means, think of it this way. Out of all possible 150-amino-acid sequences, the chance to randomly get one that works is about the same as if you and I got teleported to two random places in the whole Universe, and we would meet. Not going to happen. And this is just the probability to make one relatively short protein.

But that's only with one try, so let's see how many tries we can have. There have been about 1017 seconds since the beginning of the universe. If there was one try for this protein every second since the beginning, the chance would be one in 1077/1017, which is one in 1060. This is still hopeless. What if we had a billion tries every second? We get one in 1051. This is getting us nowhere near any realistic chance. We would need about 1060 attempts every second to have a reasonable chance. The Earth doesn't even have enough resources for something like that. In fact, calculations were made by Stephen Meyer, David Swift, and others to see if utilizing the power of the whole Universe would help. This included using all the atoms in the Universe, all the time available (13.8 billion years) and as many attempts per second as the laws of physics allow. This is of course far from what's realistically possible. Life on Earth only had the atoms in Earth's oceans (or whatever there really was then) to work with, not all the atoms in the Universe. The needed reactions take time, so it's nonsense to think there could be trillions upon trillions of tries every second. But even with all the theoretically available power, the result was nowhere near a realistic chance to get anything useful.

If the odds are one in 1077 for a 150-amino-acid sequence, then for 1500 amino acids, it's roughly one in 10770, and for 15,000, one in 107700. (The calculations probably don't work out exactly like that, but a trillion times more or less really makes no difference here.) Would we need that much? Unfortunately, yes. Most proteins have hundreds of amino acids, the average is about 400-500, a lot more than a measly 150, and the longest known ones have over 30,000. So this goes way beyond even picking a specific atom in the Universe. There isn't even anything to compare chances this bad with. It's like, "I'm thinking of a number between 1 and 1010000 (1 with 10,000 zeros). Guess the number!" Nobody would try even if the range was only from one to a million, i.e. six zeros. These odds are totally crushing.

For those mathematically impaired, I decided to spell out 1077:
100,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000
If you tried that many times, you might get one protein of 150 amino acids. Copy/paste the zeros 10 times to get 10770.

Another example for those who can only count to 10 would be this: Imagine I travel to a random place on this planet, find a random book somewhere, open it on a random page, and circle a random letter with blue ink. Then you travel to a random place, find a random book somewhere, open it on a random page, and circle a random letter with red ink. How likely is it that the same letter is now circled with both blue and red ink? Would you be willing to bet on the chance that we'd select the same letter in the same book? If you believe in evolution, that's the kind of chance you're betting on.

Normally, if your scientific theory is facing odds like that, you know your theory is utter nonsense and you need to flush it down the toilet and look for something else. There's a better chance that Santa Claus really exists and lives at the North Pole. Finding a needle, not in a haystack but in our galaxy, is a piece of cake compared to the odds of evolution happening. Winning the lottery every month for a year would be easier. Outside of evolution, everyone knows that putting any hope in something this improbable would be quite idiotic. Yet evolution can only happen if such odds are overcome all the time (millions of genes must have existed in the history of Earth), and the Darwinists see no problem with that. It's bizarre that evolution is being taken seriously by anyone sufficiently acquainted with the topic.

DNA replication. 32 complex proteins needed.
According to true believers, what you see here
is an unplanned accident. Stupid atoms just
bumped into one another, then this happened.

The Darwinists irrationally dwell on the idea that very small steps and enough time can overcome anything. But we've seen that even all the time in the world isn't nearly enough, and small steps aren't even possible with new genes. It's like thinking that you can make a hammer from a piece of wood in small steps. You can't. At some point you need something that's not wood - like steel - and that's a big step no matter how you look at it. You can't mutate a fish into a bear any more than you can mutate wood into steel. In fact, scientists mock alchemists for believing they could transmute lead into gold, but that's actually far more realistic than mutating a fish into a bear. Who's the primitive medieval moron here?

But let's go further and ignore even these problems for a minute. Let's say new genes can be made with the same ease with which mutations occur in existing genes. Now, if birds evolved from dinosaurs, then how exactly did wings evolve one step at a time (ignoring the genes issue)? First we have to realize that absolutely nothing in the organism is trying to make a wing. Every step leading towards a wing is an accident. Thus the organism could accidentally be building hundreds of other things. A wing may need thousands of mutations. But because the wing is not a goal - there is no goal whatsoever - then for every mutation leading to a wing, there would have to be hundreds or thousands that lead to other things. If we get 20 mutations leading to a wing, we may very well not get another one ever. Like I said, nothing is trying to make a wing. There's no plan, no goal. In the meantime, we might also be getting 20 mutations leading to all kinds of other things. So how is it possible that we end up with 100% of a wing, and 0% of anything else, something unfinished? That's a nonsensical outcome. We should be seeing all kinds of unfinished things everywhere because evolution should always be in the middle of something. But not only do we not see any never-finished things, we don't even see unfinished versions of wings and other things that now do exist, neither in the fossil record nor around us.

Here's another angle on this. "If we evolved from monkeys, why are there still monkeys?" (Yes, yes, we didn't evolve from 'monkeys', we evolved from a 'common ancestor' with monkeys. But this ancestor was a goddamn monkey anyway, so shut up, Dawkins.) This is actually easy to explain. Imagine North Koreans would evolve into something that's not human anymore (something better, of course). How would this evolution affect South Africans? It wouldn't. (It's a strictly northern evolution.) And once there is a new species, interbreeding shouldn't be occurring. So if this happened, most humans would remain humans. If something new appears, the old version doesn't usually just disappear, due to geography and other reasons. There will be separate populations in separate places. And if some North Koreans moved and married elsewhere in the middle of this evolution, there would be hybrids in all possible stages. If the whole population doesn't regularly mingle (thus evolving as a whole), there will be all stages existing somewhere. If evolution is random, then it can get stuck at any stage in various geographical places. I mean, if evolving into a new form meant the end of the old form, there would always be only one species, but that's not how it works, clearly. Not only are there monkeys; there are still bacteria.

For this reason, there should be plenty of species with semi-evolved wings and semi-evolved just about anything else. If not around us, we should see them in the fossil record at least. But we don't. There is no bird with a half-arm/half-wing (never mind 20/80, 40/60, and everything else), or with a half-mouth/half-beak, nor an elephant with half-nose/half-trunk, and so on. This precision of results stemming from random processes is inexplicable. If the evolutionary processes are slow, there should be a full range of intermediates not only in the fossil record, but all around us.

Of course the evolutionists believe that natural selection is basically the Jesus of evolution and it can do anything, but this is nonsense. First of all, natural selection can only act on something that actually happens. We've seen that most of the required events will never happen at all. And then, even if a small change does appear, natural selection can't do anything about it. One percent of a new organ (another bizarre idea in and of itself) is not going to make you have more offspring than those around you. Natural selection isn't going to kill off everyone else if one specimen 'evolves' 1% of antlers. Just as natural selection won't kill off those with 24% antlers when something with 25% antlers appears. Even in a world with 100% antlers, individuals with only 10% or no antlers at all can survive and reproduce. And while polite commentators would say that natural selection would be 'very unlikely' to sort through such miniscule differences, I feel like we should use more accurate language and plainly state that such an idea is simply complete bullshit. It's idiotic to propose that natural selection can distinguish between two things that are 0.01% different. The natural variation between surviving specimens is orders of magnitude larger than that. There is no selection for a single mutation unless it has huge impact on survival, which can only happen under massive environmental stress. Otherwise, the non-mutants survive just fine.

compucell

It's also incredibly short-sighted and dumb to assume that there's a viable step-by-step pathway between any two things. How would you go from a microwave oven to a bulldozer one step at a time, with every step being more useful? What would you say would be the mid-point between a microwave oven and a bulldozer? I can't imagine. Natural selection is not only pretty useless for evolution but would actually prevent macro-evolution. You can't keep improving a microwave oven until you have a bulldozer, and you can't keep improving a fish until you have a bear. The logical results of incremental improvements in these cases are a very good microwave oven and a very good fish. There's no step-by-step pathway to a bulldozer, and there's no step-by-step pathway to a bear.

Having done some calculations, we can quickly return to the origin of life. In 1983, Sir Fred Hoyle calculated the odds of producing the proteins necessary for a simple one-celled organism by chance at 1 in 1040000. Douglas Axe did his own calculations several decades later and arrived at 1041000. That's forty-one thousand zeros. It would take you half an hour to even write this number.

So it's about one in 1041000 for the origin of life, and anywhere from roughly one in 1050 to one in 1015000 for single proteins, and we need millions of them. For the whole of evolution, you'd have to multiply all these numbers. And of course there's much more that would have to happen. The overall probability of evolution would be 0.00000000...???...00000001%, where in place of "???" we would have a whole library of books filled with zeros. It may still be 'theoretically possible', but it's physically impossible because, as we've seen, the whole universe doesn't have nearly enough time and atoms to beat the odds.

One fun thing some evolutionists do to overcome the improbability is to invoke a multiverse. If there is an infinite amount of universes, then there's an infinite number of attempts at assembling life randomly. So anything, no matter how improbable, will happen somewhere. Pretty smart, huh? Well, let's just say that if the only way you can make your theory work is to invoke something that makes literally anything work, you're a moron, and your theory is rubbish. You are more desperate than the "God did it" people.

So what does it take to believe in evolution? You have to suck at mathematics, and you have to suck at biology.

Darwinism ignores reality. Macro-evolution is impossible.

Part 5 ♦ The Theory of Evolution is Anti-Science  [Source]
darwin
If at least this part of Darwin's theory is
correct, then neo-Darwinian scientists
today are an endangered species.

In their desperate attempts to discredit anything that even remotely makes sense, Darwinists like to ask the question, "Is ID (Intelligent Design) science?", to which, of course, they answer "no" based on a random ridiculous claim of the day. But that's not the correct answer. The correct answer is, "Who the f**k cares?!?" If you had one theory that happens to be correct but isn't "scientific" (whatever that means) and another one that's perfectly "scientific" but happens to be wrong, you'd have to be an idiot to pick the one that's wrong. And by even just asking the question "Is ID science?", Darwinists are designating themselves as being exactly this kind of idiot. They'd rather be wrong than acknowledge the existence of any kind of intelligence.

So if you let somebody convince you that the question of whether ID is "science" is important, you've already been duped and have little chance of figuring out the truth about anything. You're not concerned with what's true or correct. You're concerned with something completely irrelevant, and while engaged in a dumb argument about nothing, you're completely missing the point.

But since this question is often being raised, let's look at just how scientific evolution itself really is.

Darwinists say ID is not falsifiable and cannot be tested, so it's not scientific. But evolution happens through random mutations, and there's no way to prove whether the mutations are or aren't random, and natural selection is not falsifiable either, and cannot be tested, so it's not scientific. This is only one of the many indications that Darwinism and the theory of evolution are at least as unscientific as ID supposedly is. There's an obvious double standard and selective blindness here. But in fact, I would say that things in the evolution camp are much worse, which I will make abundantly clear.

What follows is a list of reasons why the theory of evolution isn't scientific. Not that it really matters much - what matters is that it's wrong - but since evolutionists like to wave the flag of science in your face, let's just show how dishonest that gesture is. If the "not science" accusation is considered a viable weapon to shoot down ID, then let's give these 'evolution' dimwits a taste of their own medicine.

  • The theory of evolution was imagined by a guy who knew nothing about the cell, heredity, and genetics. The theory was later shown by genetics, and the discovery of DNA and the complexity of everything in the cell, to be totally implausible. But instead of acknowledging that it doesn't work, evolution is being promoted as fact. We're told that species evolve into other species, even though nobody can explain how it could happen step by step, and nobody has ever seen it happen. That's not science. That's dogmatism of the worst kind.
  • Darwinists absolutely cannot explain the origin of life. Their attempts to do so invoke mechanisms that have never been observed in nature. That's not science. They are often reluctant to even admit that DNA contains very sophisticated code. They have no way of dealing with that fact. The only origin of a code that we've ever observed is design. Therefore the only theory of the origin of the code in the DNA that can be called scientific is that it was designed, because that's the only theory that reflects our real-world, observable and provable experience. But instead, Darwinists suggest ideas that are completely improbable and have never been observed to work. That's as unscientific as you can get. It's like observing all your life that nails end up in wood as a result of being hit by a hammer (or similar device), and then seeing a nail in wood and claiming that it must have accidentally sunk in. Why? Why ignore what you've been observing your whole life? The idea that atoms self-assemble into complex, functional living cells is not scientific. Saying "Yes, it's very improbable and nobody has ever seen it, but it happened!" is like saying "Yes, I know nobody has ever seen a Unicorn, but they exist!" No scientist takes such claims seriously, except in the case of evolution.
  • The idea that 'things could have started simple' and evolved gradually is nonsense. The smallest bacteria make hundreds of proteins. Nobody has a clue how a cell could function with, say, just a few dozen proteins. Just making a protein requires over a hundred already existing proteins. Replicating DNA requires 32 proteins. Suggesting all of these things could work with less, even though nobody has a damn clue how, is not science. It's just bullshitting one's way out of the fact that evolution doesn't work. These ideas are completely unrealistic and serve only to artificially keep alive the evolution zombie. Either you can show how it could work, or you're just making things up.
  • The interdependence of things in the cell and in living organisms shows that evolving such systems gradually doesn't make any sense. You can't make proteins without DNA, but you need proteins to read, transcribe, and replicate DNA. There are so many chicken-and-egg problems in biology that it's ridiculous. What's the explanation? "We can't really explain it exactly, but we know it happens." How do they "know"? They don't. They believe it. It's a dogmatic belief, not science.
  • If something is supposed to happen by random chance, we have to ask, what probability is there that this could really happen? If we find that the probability of such things happening is one in 10100 or one in 105000 or one in 1040000 or more, as it is with evolution, we know that our theory is garbage. If we asked 5-year-old children how life came to be, it is unlikely that they would have a worse theory than something that has a one in 1040000 chance of happening. Please spend a few minutes thinking about the fact that it would be difficult to make up something that's less probable than evolution.
  • When evolutionists concoct their theories on how something could have evolved, they focus on what they want to happen, not on the 9,999,999,999 things that could go wrong at every step. This is because they take species 1 and species 2, decide that 2 evolved from 1, and try to find ways how it could be possible, which means they have to make things up. Anything even marginally helpful, no matter how improbable, is accepted. This is somewhat understandable, though as stated above, the improbability of evolutionary mechanisms is way above the improbability of anything else. What's worse is that all potential problems, generally quintillions of times more probable than the required lucky events, are ignored. It's like explaining that a broken car was fixed by smashing it randomly with a hammer. All the focus is on how the hammer could, against all odds, hit the right spot. What's ignored is that you need many tries and every single hammer blow is likely to break things more. A theory that puts infinite hope into something infinitely improbable and brushes aside a huge number of things that are very likely to go wrong is not scientific. It's the antithesis of Ockham's razor.
  • The only kind of "evolution" ever observed has been minor mutations that happened to lead to some survival advantage under the present conditions. To extrapolate from this towards infinity, ignoring biological realities, mathematics, simple logic, and common sense isn't science. A single observed mutation in DNA has no way of explaining how a whole new gene could arise by chance. Let me repeat that, because this is really important. A single observed mutation in DNA has no way of explaining how a whole new gene could arise by chance. They are two separate problems, orders of magnitude apart. Any science actually done on that topic shows that new genes won't evolve by chance even with the entire age of the universe at our disposal.
  • Evolution ignores the main physical evidence: the fossil record. The reaction to discovered fossils is along the lines of "Wow, that's weird. How are we going to make this fit our evolutionary model?" Nothing in the fossil record makes sense in the context of evolution, but the apparent imperative is to somehow do our best to make it make sense. Occasionally something is found that seems to support the evolutionary model, and then they all say, "Ha! See? We told you so!" Then you ask what about the 99% evidence against evolution, and they all pretend they didn't hear you. Science should go from evidence to creating plausible theories. Evolution starts with an implausible theory and tries very hard to fit the evidence into this theory, even though it keeps failing.
  • According to the theory, the path from one species to another should be a gradual continuum. In the sense of evolution, there are no final forms of organisms. Everything is supposed to perpetually and randomly change. If evolution is driven by mutations and natural selection, then it should never stop. Mutations always occur, and natural selection has no way of stopping. But what we see in the fossil record is the appearance of organisms out of the blue, then long stretches of time where they are unchanged, and then their sudden disappearance. Observed reality is completely at odds with the "scientific" predictions of Darwinism, yet the promotion of this nonsense as "proven science" never changes. Ignoring inconvenient evidence is not science.
  • Speaking of predictions, Darwinists accuse ID of being unable to make any predictions (which is neither true nor relevant, but you get used to that kind of twisted logic when dealing with Darwinists.) But what predictions can Darwinism make? There is absolutely nothing specific that the theory of evolution can predict. All it can say is that species may randomly change into other species over time. ID predicts that they won't. So far our observations have not shown a single species, alive or extinct, evolving into another, so ID's prediction is consistent with what we see. Darwinism has only one very vague prediction, and it has not been confirmed by observation once.
  • Darwinists constantly glorify any evidence that even remotely speaks for evolution (which it often does only in their heads) and ignore evidence against it. Real science is less concerned with supporting evidence and more with evidence against the theory being tested. If you observe five facts that support your theory, you're far from proving that it's correct. But if you observe one single fact that disproves your theory, your theory is wrong. It's over. You can go home. Think about it some more and look for another solution. There's very little evidence for evolution and heaps of evidence against it. Darwinists either explain this undesirable evidence away by their implausible fairy tales or ignore it completely. That's not science - just wishful thinking.
  • A step-by-step evolution of complexity is assumed, with no evidence. Nobody has been able to explain how irreducibly complex systems could have evolved one step at a time, yet we're supposed to accept that they have, because some very smart (according to themselves) men say so. If an idea has no evidence to support it and no theoretical model to explain it, it's not scientific. "We believe it's possible" is not science.
  • Random mutations and natural selection are both poor candidates for producing novelty. Mutations produce mostly garbage, and natural selection can only eliminate the worst of that garbage. Neither of the processes has a plausible way of creating anything new. Promoting the idea that noise creates functionality, when all our experience tells us otherwise, is not scientific.
  • Evolution contradicts established scientific principles, namely information entropy. We're told that the information content in the DNA increases over time with no intelligent input, yet this makes no sense. Entropy dictates that the information content will decrease (which we actually do observe whenever we care to look). The only thing that can infuse new, functional information into a system is intelligence. Accidents don't do that. The theory of evolution is anti-science.
  • Darwinists work backwards from speculative conclusions towards interpretation of facts. They have decided that evolution must be true, and for every new discovery, they have to make up a story for how it fits into the sanctified evolutionary model, which usually involves some significant mental gymnastics and suspension of disbelief. Science should be about looking at what actually happens and figuring out how it happened, not about deciding how things happen and then making up theories about how the evidence fits their pre-formed belief.
  • Evolutionists dogmatically insist on falsities, ignoring well-known facts. One of the many examples is the appendix in the human body. This organ is known to have at least two functions, acknowledged by even something as mainstream as Wikipedia. Yet we keep hearing that the appendix is a "vestigial" organ and can be explained only by evolution. Many examples of similar claims relentlessly repeated despite having been proven false (often decades ago) can be found in Jonathan Wells's book Zombie Science. The obvious reason why false evidence keeps being thrown in our faces decade after decade is that there is no true evidence for evolution.
  • Evolutionary explanations usually say why things evolved, not how. If it cannot be shown how something has evolved step by step, insisting that it did is not different to a religious belief. "Giraffes have evolved long necks so that they could reach higher." HOW? "This monkey has evolved a long, thin finger so that it could reach inside holes to extract insects." HOW??? Scientists cannot explain how anything evolved. Ironically, explaining why is only hinting at intelligent design. Evolution is supposed to have no purpose. So explaining why something evolved doesn't even make sense in the mainstream science paradigm. In evolution, the answer to "why" always has to be "for no reason at all".
  • After 160 years, the theory of evolution is more controversial than ever, still trying to make things work. Instead of it strengthening during the 16 decades of scientific research, the theory of evolution has become increasingly dubious. If 160 years of science have made the theory less plausible than ever, it would seem that this theory and science aren't very compatible.
  • In dealing with what is or isn't science, evolutionists hold the view that the only real science is natural science, i.e. materialist science. But materialism is an ideology, no more proven to be true than the Bible. Materialism, just like religion, is a dogmatic belief. So saying that the only science that counts is materialist science is about the same as saying that the only science that counts is religious science. Evolutionists hold a certain belief and define science as operating within the limitations imposed by that belief. This then gets very stupid very quickly. You end up being told that your consciousness doesn't really exist, your decisions aren't made by you but by your genes, and other nonsense. Objectivity evaporates as learning about reality is limited by arbitrary assumptions.

Darwinism is a disgrace to science. It ignores many scientific principles. It ignores facts and evidence and instead insists on a dogmatic belief, just like religion. Darwinists need to wake up and stop treating their unassailable theory like a sacred cow. They're doing exactly the things they accuse Creationists of.

The theory of evolution is not just wrong. It is unscientific, nonsensical, illogical, and mathematically impossible.

Part 6 ♦ Richard Dawkins and Half a Wing  [Source]
dawkwing
Evolution in progress. You are now
obsolete and awaiting removal
by natural selection.

What good is half a wing? That is the question. If wings evolved step by step on some wingless species, there had to be half a wing at some point, so we might ask this question. In fact, we might ask lots of questions, because nothing about Darwinian evolution really makes sense, but this one is traditional. So let's ask, what good is half a wing? And who could enlighten us better than Richard Dawkins, the king of evolutionary explanations. He spoke thus in his highly delusional book The God Delusion:

quote big

Half a wing is indeed not as good as a whole wing, but it is certainly better than no wing at all. Half a wing could save your life by easing your fall from a tree of a certain height. And 51 per cent of a wing could save you if you fall from a slightly taller tree. Whatever fraction of a wing you have, there is a fall from which it will save your life where a slightly smaller winglet would not. The thought experiment of trees of different height, from which one might fall, is just one way to see, in theory, that there must be a smooth gradient of advantage all the way from 1 per cent of a wing to 100 per cent.

If Richard Dawkins had 1% of a wing, he'd be really happy to have such a magnificent evolutionary advantage. He could fall from 1cm higher than you without dying. His offspring would fill the earth, and we would all die out. Natural selection would somehow make sure of that. 1,000 generations later, somebody would evolve 2% of a wing, and the one-percenters would die out because there's no way they could compete with 2% of a wing. This has to happen very slowly and gradually but never leave any incriminating evidence in the fossil record. It's evolution, baby!

To be honest, I'm not entirely sure what 1% of a wing would look like. Would it even be visible? I envision myself standing on top of a mountain with two little bumps on my back (or just one??) and looking down at the puny humans dying left and right as natural selection rolls through them like an Israeli bulldozer through Palestinian houses, showing them no mercy. Take that, wingless suckers!

But it's a bit difficult to imagine how exactly this could work. On one hand, the process has to be slow and gradual; on the other hand, the intermediate stages seem to disappear quickly and perfectly enough to not leave a trace. Do unevolved forms stay or disappear? Monkeys are here. Half a wing is not. How does natural selection decide? It seems like it evolves new forms very slowly while killing off the intermediate forms very quickly and completely, which is strange, because evolving the new forms and killing off the old ones should be one and the same process.

But what's really disturbing about Dawkins's explanation is that he thinks that you, the reader, have half a brain (at best). He acts like wings evolved from nothing, even though he should damn well know, unless he's even dumber than I think (which would be rather difficult), that wings evolved from arms. On dinosaurs. Or at least that's the idea of these silly people who believe in evolution by natural selection. Why is this important? Well, half a wing may be better than no wing at all (though if you ask my opinion, until you can fly, it's mostly just dead weight), but if the wing evolved from an arm, then half a wing also means half an arm, and the dinosaur started with a whole damn arm. How is something that's half a wing and half an arm better than a whole arm? I have no idea, but I'm pretty sure I'd rather have a whole arm. With this half-assed (or half-winged?) thing, I feel like not only I would I not be able to fly yet, but I probably couldn't do a lot of things that I could before, when I had two good arms.

evofish

Somebody call Dawkins and ask him about it. You'll probably learn something new that makes no sense, so it could be fun. It's been said about him that he knows more things that aren't true than perhaps anyone alive. I think this is a very acute observation! He really seems to have an endless supply of elaborate explanations that are wrong. (One might call it sophisticated bullshit.) For example, he said this in one of his ridiculous books:

quote big

Fascinatingly, it is very obvious in human embryos, whose 'pharyngeal arches' are clearly derived from ancestral gills [clearly!], as one can tell by looking at their detailed anatomy. Of course they don't function as gills [because they're not], but five-week human embryos can be regarded as little pink fishes, with gills. [So they don't function as gills, but you can regard them as gills, because...???] I can't help wondering, once again, why whales and dolphins, dugongs and manatees have not re-evolved functional gills. The fact [or rather, delusion] that, like all mammals, they have, in the pharyngeal arches, the embryonic scaffolding to grow gills suggests that it should not be too difficult to do so. The Greatest Show on Earth, 2009. [Comments mine.]

Oh my. So many things you can believe here, if you're dumb. How does Dawkins know these things are derived from gills? Well, just by looking, duh! There are four or five vertical lines, and that's what gills look like, so that's clear evidence. If you know some other things that have four or five vertical lines, you know what they evolved from! And you also know that when you were a five weeks old embryo, you were really a little fish. And look at you now, you can read and stuff.

So why don't whales re-evolve gills? It should be so easy. Dawkins could probably do it, if he really wanted to. But then, whales are probably not as smart as he is. Or maybe... it's because there are no gills in mammal embryos, no creature has ever 'evolved' a new organ, and Dawkins is talking rubbish as usual. (Also, mutations are random, so expecting a specific set of mutations to show up when needed makes no sense.) Let's ask William Fix:

quote big

It has been known for almost a century that at no stage of its development does the human embryo have gill slits. There are simple folds in the tissue in the region which later becomes the neck, but to refer to these as gill slits is about as accurate as referring to hands as antennae. The Bone Peddlers, 1984. [Emphasis mine.]

See? Between 1984 and 2009, humans evolved retarded ideas almost to perfection! (Most of the credit goes to Dawkins.) Just imagine where we'll be in a million years! We'll know so many things that are wrong that... I don't even know how to finish this sentence.

One more question about the wings, though. If this dinosaur that's evolving wings can't fly yet due to insufficient wing percentage, why the hell is it climbing trees? Chickens kinda suck at flying, but they're usually smart enough not to climb tall trees (despite generally being pretty dumb). They actually have 100% wings, but I'm not sure those are very useful. What survival advantage are the wings giving chickens over, say, cats? Can chickens really fall from higher up than cats and survive? Can they get that high in the first place? I would bet my money on the cat, even though it has 0% wings. (Unless it's already evolving and has 1% and nobody has noticed yet. "Doctor, my cat has this little bump on its back. What could it be?" "Oh, don't worry about it. It's probably just evolving wings.")

If Dawkins' explanation were to really make sense, falling from trees would have to be a major activity of these dinosaurs, as natural selection would require many of them to die as a consequence of it, so that those with 1% more wings could survive and drive evolution forward. It's difficult to imagine that any animal would be so stupid that it would regularly climb trees, fall from them, and die. Animals tend to either be very good at climbing, or they don't do it at all. And I'm pretty sure suicidal activities and stupid competitions were only invented by humans.

I'm a bit perplexed about these percentages, to tell you the truth. For example, how is 46% of an egg better than 45% of an egg? And is there 46% of a bird inside? How does it work? How do you get 1% of an egg, and what does it do?! It seems to me like an egg is pretty damn useless unless complete, but maybe I just lack Richard's imagination. I think he may have evolved a better understanding of evolution. (Meaning he's better at making things up.)

This is even stranger given that the changes have to be so small and numerous that there would usually be a lot more than 100 of them, so 1% change is actually big. The evolutionary battle is thus between elephants with 76.8% of a trunk and elephants with 76.9% of a trunk. Somehow natural selection with an IQ of zero can tell them apart and make sure the ones with 76.8% cannot reproduce, which is, frankly, quite fascinating, especially given that elephants with 0% of a trunk must have survived long enough to produce elephants with 0.1%. I can see why Dawkins calls it the 'magic of reality'. I mean, reality may be in short supply in the things he says, but there certainly is plenty of magic.

feather1
Feel free to explain how this evolved
accidentally step by step and how
each of those steps made
the creature produce more offspring.
Nobody has so far, so you can be first.

The big question here is, what does half a wing look like? Is it like a whole wing, but half the size? No, that would make no sense. It would genetically be a whole wing, just small. We're talking about cumulative mutations, so in evolutionary terms, half a wing should have half the mutations needed for a whole wing. But what would a wing with half the genetic code be like? What would it be missing and how would it be useful? These are all questions that should be answered before we can just naively claim that half a wing is better than nothing. If gaining half a wing means losing half an arm, this half a wing had better be worth the price.

Let's think about how this would actually work. What do we need for a wing? Some bones (which should come from the arms, so those just need various modifications), some muscles, lots of feathers, the right shape and position, and so on. It's hard to imagine how this could form from arms one step at a time. But there are a few big steps that would seem necessary, so for the sake of argument, let's go with roughly this:

  • Feathers must grow on the arms.
  • The shoulder joints have to be modified for different movements, and many muscles need to change significantly.
  • The shape of the arms has to change into the shape of wings. (Sloooooooowly.)
  • The fingers, along with their original functionality, have to disappear.

I think the last one has to be last because, until you can fly, the fingers are the most useful part. But what about the order of the other three? If the shoulders start changing shape for flight, what survival advantage is there at this point? The arms would just become awkward to use. And if the shape and proportions of the arms start changing first, things get weird too. I suppose feathers can grow first. So you can have an arm with feathers that can't fly. You have to start with a few small feathers. Looks like some of the dinosaurs actually had this, if we can believe the drawings in books (although, as Jonathan Wells has shown, we can't, but whatever.) But how did they get feathers on arms? Was it really driven by natural selection? The other dinosaurs were surviving just like the feathered ones until they all went extinct, so how are feathers on arms useful for survival? Hell if I know. I mean, imagine you have some feathers on your arms. Would that make your life easier and allow you to have more children? I highly doubt it.

Anyway, let's say we have arms with feathers. Then what? Either the shoulder complex has to morph, or arms have to change shape into wings. But both of those options would seem to make the arms worse while getting us nowhere near functional wings. The arms had the ideal shape for functioning as arms. If they can't be used as wings yet, any change from arms towards wings would just make them worse arms. And even if we somehow got through those steps, it's still fascinating that there are no birds with hands and (visible and functional) fingers on their wings. Presumably they weren't able to survive, even though they must have for millions of years before they evolved into fingerless birds. And are wings without fingers really better than wings with them? Fingers are pretty useful, in my experience. Why would birds with fingers on wings die and ones without them survive?

But everything mentioned so far is just a rough outline. There are hundreds of details to take care of. The feathers have to become much more refined and complex in order to fulfill the required function. In fact, even just the evolution of feathers is totally inexplicable by means of mutations and selection.

barbules
"Distal barbules with hooks and
proximal barbules with grooves".
Apparently random mutations are
smarter designers than most humans.

Michael Denton addresses the problems with evolution of wings in great detail in his book Evolution: Still a Theory in Crisis. Here's an excerpt dealing with feathers specifically:

quote big

Every aspect of feather origins bristles with challenges to Darwinian scenarios. To take a minor example, without apoptosis of the cells between the barbs and barbules (as in the developing digits in the auto-pod) neither barbs or barbules could exist as separate filamentous structures. What came first, the cellular condensation, that created the barbs (which occurs first in the development of extant feathers), or the apoptosis (which occurs after the development of the barbs in extant feathers) that separated them into discrete filaments? Only if both developmental processes are in place can the adaptive end of a branched feather be actualized, which again raises the specter of evolution per saltum. Again, severe problems arise in trying to imagine a Darwinian scenario for the origin of the barbules and their subsequent differentiation into distal barbules with hooks and proximal barbules with grooves, which inter-lock together, binding the pennaceous feather into a closed vane. In attempting to reduce feather origins to Darwinian scenarios, we are led not only into "endless absurdity," but into direct conflict with what is known of the developmental processes underlying the ontogeny of the feather. There is no sanction in the developmental processes underlying feather ontogeny for one-by-one, bit-by-bit Darwinian functionalist approaches.

[...]

The origin of the various feather novelties and the developmental processes that actualize them are enigmatic in classic Darwinian terms. Prum and Brush conclude:

By emphasizing the reconstruction of a series of functionally and microevolutionarily plausible intermediate transitional states, neo-Darwinian approaches to the origin of feathers have failed to appropriately recognize the novel features of feather development and morphology, and have thus failed to adequately explain their origins.

Evo-devo research on the feather has finally laid to rest the Darwinian "frayed reptile scale" scenario. Feathers and scales are fundamentally different skin appendages. As Thor Hanson comments: "What Prum recognized now seems obvious: there is a fundamental structural difference between scales and feathers and how they grow." Although it is clear that the feather was actualized in stages, which can be followed in the fossil record, there are no known adaptive sequences leading gradually to each of the novelties or new homologs. Evolution: Still a Theory in Crisis, 2016.[Emphasis mine]

So we don't even know what feathers evolved from, much less how. We have no clue what 1% of a feather would be and how it could be useful. The complexity of a feather is staggering once you look at the details. But this is the thing about evolution - it only seems plausible if you know almost nothing about biological structures. Once you look at the actual complexity of something like a feather (or really just about anything) and are tasked with figuring out how this could have come about accidentally, step by step over millions of years, and how each of the steps would result in producing more offspring, you have to be Richard Dawkins to still believe it's possible and makes any sense. Then you just say that 25% of a feather is better than 24% of a feather, and it doesn't bother you at all that nobody has any idea what 24% of a feather would be like, how it would evolve on the genetic level, and how it would increase birth rate. You have to live in your own world and not be bothered by reality.

We should even talk about things like 'accidental aerodynamics'. It's not that easy for a pair of accidental structures to be able to carry a pile of meat they're attached to across the sky. Most people couldn't design functional wings, so what are the odds they would come about by chance? The wings are composed of many parts, each being exactly the right thing with the right shape in the right place. How does any fraction of it perform a useful function? Does it really even ease your fall from a tree? Dawkins seems to think that 50% of a wing has 50% of a full wing's efficiency, but this idea is extremely naive and shows massive ignorance. Let's look at 50% of a chair. With only two legs and half a seat (or maybe all four legs and no seat?), is it really half as good as a whole chair? Or is it something that you just won't use as a chair at all because it's useless? How about 50% of a computer? Is it half as good as a whole one? Does it perform a better function than 49% of a computer? Does it perform any function at all? This simplistic view of an increasing percentage of something resulting in gradually increasing efficiency leading to producing more offspring is simply delusional.

halfwing
Asymmetric evolution, 50% complete.
94.3% plausible if your name
is Dawkins.

Is 2% of a knife really better than no knife at all? (What the hell is 2% of a knife? A tiny piece of metal?) Is 2% of a box really better than no box at all? (What the hell is 2% of a box? A small piece of paper?) Is 2% of a car really better than no car at all? (What the hell is 2% of a car? The windshield?) Dawkins seems to operate under the illusion that 2% of a knife cuts 2% as good as a whole knife, and that 2% of a car goes 2% as fast as a whole car, but of course in reality, if you only have 2% of a car or a knife, you ain't goin' nowhere, and you ain't cuttin' nothin'. 2% of something isn't even recognisable as having anything to do with that something. These ideas can only come from the head of someone who hasn't really thought seriously about the topic. Just think about the usefulness of 1% of a light bulb, 1% of scissors, or 1% of a Rubik's cube. Just like these things, 1% of a wing is not only useless and serves no purpose - it's not even recognisable as the object it is supposedly a part of, and it certainly won't make you produce more offspring, which is the only thing that could make evolution by natural selection work.

By the way, while the dinosaur was evolving wings by falling from trees, it also simultaneously evolved a beak and kinda became a bird with no evidence of half a bird and half a dinosaur with half a wing and half a beak ever having been seen anywhere. (I hope that at this point everyone knows that the infamous Archaeopteryx was not an ancestor of birds. Also it had whole wings and no beak.) So I don't know. This evolution thing always gets a lot more difficult once you try mixing it with common sense, never mind biology. Somebody tell me how to evolve a wing step by step in the comments. I have no idea. Bonus points for evolving a beak at the same time.

Dawkins seems to think it's really easy to gradually evolve wings, but he never quite explains how. For him, wings just evolve one percent at a time, and with each percent you can fall from a taller tree. How it fools anybody above the age of 5 is beyond me. Also notice that he insists on a continuous gradient where each extra percent is better than the previous state, which in the long run implies that if evolution is true, whole wings are way better than arms. If they weren't, they could never have evolved from them. Why did birds evolve 100% of wings and all other armed creatures (that's creatures with arms, not guns) not even 5%? Guess we'll never know.

horns
All these horns and antlers evolved by
natural selection, because anything
less just wasn't good enough. Which
shape of horns is the best for survival?
All of them, apparently. Bottom right
looks very convenient when eating.

But the mysteries don't end there. If even 1% of something is better than nothing, then how did snakes evolve from lizards? Because supposedly those went from 100% of legs to 0% and thus became better. This seems to be kind of backwards. It's like lizards didn't understand percentages and accidentally evolved in the wrong direction. Think about the role of natural selection that first evolves legs because they're much better than no legs, and then evolves no legs because that's much better than legs. What part of a leg do you lose first to become an evolutionary improvement over someone with whole legs? Are 3 legs better than 4? Beats me. Call Richard. I'm sure he'll make up something incredible. Literally.

It's also interesting that all lizard-snakes with half a leg went extinct, even though they had to be better than the original lizards that still survive. I mean think about that. Things supposedly evolve from not very good, to half good, to good. But around us and in the fossil record we see the good and the bad (and the ugly!) but never the half good. How does that make sense? Why does the bad survive and the half good disappear without a trace? If everything is supposed to be a gradual continuum, why do we see the 'before' and the 'after' but not the 'in between', even though it should be the largest part?

Think about the evolution of eyes. It can only work because having a larger fraction of an eye is better than having a smaller fraction. Like, if it wasn't such a bid deal, then natural selection wouldn't promote it, right? So if it's so clear that eyes are better than no eyes, why, after 3 billion years of evolution, are there still animals without eyes? Evolutionists claim that eyes have evolved over 40 times independently (no, seriously - don't laugh), so it can't be too hard. Having eyes is great for survival, which means having no eyes is bad for survival, which should translate to eyeless things not surviving. But they do. What the hell? It's like they don't care about evolution at all. They seem to be blind to the evolutionary requirement that they die out!

Honestly, the idea of evolution being driven by miniscule differences is ridiculous. The natural variations in one species give us larger differences than a single mutation can provide, and all these different individuals survive. Look at sizes - one individual can be 20-30% larger than another of the same species. So how could 1% of a difference drive evolution? Animals with a cut off tail can survive just fine, so how could a tail evolve under the imaginary 'pressure' of natural selection? Elephants with no tusks can survive just fine, so how can 1% more of a tusk drive evolution? Where is the selective pressure coming from? Animals with broken horns or antlers can survive just fine. If an elk really needs antlers for survival, why doesn't a horse? Antlers are an example of a structure that's absolutely not necessary for life. Sure, they can be useful, and they look cool, but their absence doesn't hinder survival, as evidenced by all the species similar to elks and moose and deer but without antlers. And if it started with 1% of antlers, how in the bloody hell did that result in more offspring? Or what about human hair? Presumably the long hair on human heads could only have evolved by natural selection, so the people with longer hair must have survived at a significantly higher rate than ones with shorter hair. So do we see bald people die or have fewer children because they're bald? Nope. None of this makes sense.

catwing
I has hundrit purrsent winx but still
can no flai. Evolushn so lame.
Maybe need moar purrsent?

Imagine a cat that, due to a mutation, has 1% wings. First of all, as I've explained, nobody would even notice, including the cat. But according to Dawkins, this cat can survive better and reproduce more than ordinary cats because "there must be a smooth gradient of advantage all the way from 1 per cent of a wing to 100 per cent". I'm sure at this point everyone can see that this is pure idiocy. Even if the cat got 50% of wings in one step, how would that be useful? Again, first you have to think about what it does to the cat's front legs, from which the wings are 'evolving'. This cat would most likely have huge trouble surviving, if anything. But let's be super generous and allow the cat to have four whole legs and half of wings on top of that. It should be 'a half' genetically, not in size, but that wouldn't really work to ease a fall from a tree, so let's allow that it can ease such a fall. (We have now created a 1000 times better theoretical advantage than mutations could ever produce in one step.) So now the cat can fall from a tall tree and survive. How often do cats fall from tall trees and die? Is it often enough for the offspring of the cat with half a wing to survive at a higher rate and slowly replace the normal cats? Does that seem plausible to anyone who actually knows anything about cats? What about the cat's other activities? Cats are good at crawling through small spaces. Wings would be in the way. They would also slow the cat down when running. Running is pretty important for catching something to eat. And let's not forget about the massive energy cost in producing these wings with all the feathers and some decent muscles. So the wings would be useful when falling from tall trees (cats can handle falling from smaller ones just fine) and a hindrance in most other activities. And that's when we've allowed genetically fully formed small-size wings to magically appear out of nowhere, with no damage to legs. Realistically we'd have wings forming from front legs, starting with 0.1%, which nobody could even detect. What good is that doing to the cat? I asked one. Cat said, "Fak ju, stupid yumans. Leaf mah paws aloan."

evodog sm
"If so much evolutionary change can
be achieved in just a few centuries
or even decades, just think what
might be achieved in ten or
a hundred million years."
Don't let molecular biology get in
the way of your delusions.

Anyway, let's check some other interesting things Richard says, like this: "No serious biologist doubts the fact that evolution has happened, nor that all living creatures are cousins of one another." Well, I can believe that Richard Dawkins is the cousin of a donkey, but I'm not sure about the rest. I've seen a lot of biologists who looked quite serious say that evolution doesn't work. How do we know if a biologist is 'serious'? It's probably when s/he is Richard's friend. As for me, it's not even that I doubt 'the fact that evolution has happened'. I kind of doubt that evolution is a fact at all. Actually no, that's not true. I don't doubt that. I know it's bollocks. (At least the Darwinian version.) And so do many others. But I think these people are dead to Richard. We must be unevolved or something.

Here's another strange thing. If natural selection eliminates all the failed evolutionary dead ends so well that we can't find them anywhere, then explain to me this: If humans have evolved from religion to materialism, then how come religion is still here? If materialists are more evolved than religious people (as Darwinists seem to believe), natural selection should weed out even people who are 0.01% religious, like it weeded out animals with any fraction of a wing. But last time I checked, there were Bibles everywhere (and also some Korans and other books of fairy tales). If evolution is true and there's no half a wing left for us to see, there shouldn't be half a materialist (that's like a hesitant, tentative one), and there shouldn't be religious people at all. How long do we have to wait before natural selection kills off all those unevolved religious people? They've been around forever and keep multiplying!

But if, on the other hand, all kinds of different things can survive just fine, then what the hell does natural selection even do? How can it drive evolution when all kinds of 'unevolved' things are still around us? Bacteria, the supposed beginnings of evolution, are still here and probably more numerous than just about anything else. Seems like they have survival figured out better than most other creatures. So if everything evolved from them because everything else was better than them, why didn't natural selection kill them off? It sure seems to have killed off all the intermediate stages between bacteria and multi-cellular organisms, and those must have been better at surviving than bacteria. So what gives? None of this adds up.

Another of Dawkins' pearls is this one (about dog breeding): "If so much evolutionary change can be achieved in just a few centuries or even decades, just think what might be achieved in ten or a hundred million years." Here, again, he bets on your being stupid and not noticing that dog breeding is an example of design and thus extrapolating from it what could be achieved by random mutations makes no sense.

But there's a second dishonest thing in that quote, namely the words "so much evolutionary change". There are limitations to the changes of any single characteristic of a species, and breeders are well aware of this. They know that by breeding dogs with the longest possible ears, they soon hit a ceiling of maximum length they can't overcome, and the same with any other feature. Also, pushing any feature to its extreme usually results in various problems, like short-nosed breeds of dogs having trouble breathing. And of course the dogs always stay dogs. There's a big difference between variation of existing characteristics and addition of new characteristics. Nothing new has ever been added by dog breeding. So a better commentary, one that I would make, is this: "If so little evolutionary change can be achieved by design, just think how hard it would be to achieve anything accidentally!" Let that sink in.

heap
Pile a solid heap of stones, then
carefully remove stones one by one.
You'll have an arch. Really, try it.
Dawkins says it will work.

Sunk? OK. Let's have another bit of 'wisdom' from Richard:

quote big

It has been estimated that there are between 1 billion and 30 billion planets in our galaxy, and about 100 billion galaxies in the universe. Knocking a few noughts off for reasons of ordinary prudence, a billion billion is a conservative estimate of the number of available planets in the universe. Now, suppose the origin of life, the spontaneous arising of something equivalent to DNA, really was a quite staggeringly improbable event. Suppose it was so improbable as to occur on only one in a billion planets. A grant-giving body would laugh at any chemist who admitted that the chance of his proposed research succeeding was only one in a hundred. But here we are talking about odds of one in a billion. And yet...even with such absurdly long odds, life will still have arisen on a billion planets - of which Earth, of course, is one.

This conclusion is so surprising, I'll say it again. If the odds of life originating spontaneously on a planet were a billion to one against, nevertheless that stupefyingly improbable event would still happen on a billion planets. The God Delusion, 2006

This is true (and completely unsurprising if you understand numbers). If the chances were one in a billion, they'd be pretty good. The only problem is that Dawkins forgot to add a few thousand zeros to that billion, to reflect the real odds. Amazingly, though, he calls one in a billion (109) "absurdly long odds" yet sees no absurdity in evolution, with its odds of 1 in 1040000 and worse. Either he's not good with numbers, or he's bullshitting you on purpose.

Here's another amazing insight:

quote big

In his book Seven Clues to the Origin of Life, the Scottish chemist A. G. Cairns-Smith makes an additional point, using the analogy of an arch. A free-standing arch of rough-hewn stones and no mortar can be a stable structure, but it is irreducibly complex: it collapses if any one stone is removed. How, then, was it built in the first place? [I'm guessing not by natural selection?] One way is to pile a solid heap of stones, then carefully remove stones one by one. More generally, there are many structures that are irreducible in the sense that they cannot survive the subtraction of any part, but which were built with the aid of scaffolding that was subsequently subtracted and is no longer visible. Once the structure is completed, the scaffolding can be removed safely and the structure remains standing. In evolution, too, the organ or structure you are looking at may have had scaffolding in an ancestor which has since been removed. The God Delusion, 2006. [Comment mine]

What a brilliant idea! Except Dawkins is, as usual, missing at least two important points.

  1. A scaffolding is a product of design in all cases we know of. (And so are those above-mentioned arches themselves.)
  2. Even if we accepted the role of scaffolding (and it would have to be quite a heavy role) in evolution, it would just add additional structures to be built (and later dismantled) by chance and thus make everything even less probable. And since evolution is already less probable than anything else anyone's ever calculated the probability for, making it less probable isn't exactly helping.

A third point could also be made, and that is, again, the fact that no such scaffolding has ever been discovered, even though it should take millions of years for it to disappear.

Basically Dawkins is saying that if the argument is that things in biology are too complex to arise by chance, he can fix that by making the process of evolution even more complex. You know, if it's too hard to build a house, you can build two houses and then demolish one. High five! Problem solved. Of course this is very common in evolutionary explanations - in order to make one thing credible, you have to throw in something else that's totally ridiculous, like solving the inconsistency between evolution and the fossil record with the idea of 'punctuated equilibrium', which basically means that things have to evolve much faster than Darwin suggested, and that again lowers the overall probability. (But hey, now we can explain all the missing fossils!)

ostrich
Natural selection spent millions of
years giving me 100% of wings,
but I just prefer running. Darwin can
kiss my behind. (If he can catch me.)

Richard also sometimes makes predictions

quote big

I predict that, if a form of life is ever discovered in another part of the universe, however outlandish and weirdly alien that form of life may be in detail, it will be found to resemble life on Earth in one key respect: it will have evolved by some kind of Darwinian natural selection.
The Blind Watchmaker, 1996

Wow, let me digest this nonsense. Om nom nom. OK. I have a prediction too. I predict that when Dawkins dies, beholds reality, and realises what kind of dumb shit he'd been spouting all his life, he'll die a second time from embarrassment. Hopefully one day, in the distant 'future', we can compare notes on whose prediction was more accurate.

Here's yet another thing he's wrong about: "The Darwinian theory is in principle capable of explaining life. No other theory that has ever been suggested is in principle capable of explaining life." Well I beg to differ. The theory of Intelligent Design is capable of explaining life, or at least organic life, but that's the only life Dawkins knows about anyway. He thinks his own consciousness is an illusion. (Basically he's delusional even according to himself.) So he's wrong in the second part of the quote.

He's also wrong in the first part. Darwinian theory cannot explain life at all. The only 'evidence' for Darwinian theory's ability to explain life is Richard's claim that it can explain life. When he was asked how the first living cell appeared, he said, "Happy chemical accident." That's his explanation. Honestly, even "It fell from the sky" would have made more sense. If we were to judge theories by their explanatory power, "happy chemical accident" would be near the bottom, along with "magic!" and "God blew his nose". So I think this theory needs about two billion years of evolution to start making some sense. As a starting point, I would humbly suggest getting rid of the word 'accident' and then the other two words. Then maybe some thinking would be in order.

An interesting (to put it mildly) claim made in The God Delusion is that natural selection 'raises our consciousness'. This is rather startling coming from somebody who believes consciousness is only a side-effect of matter. How does something (a theory that's wrong, nonetheless) 'raise' the side effect of your brain activity? And what is it good for? If your consciousness is just an illusion, as Darwinists believe, what's the point of 'raising' it? And raising it to what? To the belief that there is no meaning in anything, and that everything, including you, is a cosmic accident? How is that doing anything good for anybody's consciousness? This is possibly the most bizarre thing I have encountered in Dawkins's books. It's almost as if he's using materialism to give you a sense of spirituality. I'm not sure how that's supposed to work, but it's pretty creepy.

Richard is also known for his claim that Darwinism made it possible to be an "intellectually fulfilled atheist". This I find interesting in the context of the fact that Darwinism is totally wrong. The inevitable conclusion then is that it is not possible to be an "intellectually fulfilled atheist" except if you are fulfilled by nonsense. But don't tell Richard. You could ruin his intellectual fulfilment stemming from concocting theories on why things evolve without being able to show how.

So what good is half a wing? Actually, what the hell is half a wing? You tell me.

Part 7 ♦ How the Incoherent Theory of Evolution Distorts Our Thinking  [Source]
mutation spider
Anybody notice how the second change is
infinitely more plausible than the first one?

In my experience, most people who believe in Darwinian evolution know very little about what the theory really says and how this evolution is supposed to work. They believe that it most certainly works, but when you ask questions about the specifics, you won't get much out of them. And if you do, it will likely turn out that what they say isn't actually true.

The theory of evolution by natural selection is like a rich folklore, full of persistent myths that refuse to die no matter how many times you prove them wrong. We have a very flawed educational system that promotes established dogma instead of looking seriously at the science that's supposed to support it, and questioning this dogma is often met with downright aggression.

You go to school, you get served the standard version of EvolutionIsTrue™, you're told in no uncertain terms that it's 'proven' (even though nobody can show you any actual proof), and if you're like most people, you probably never question it or think about it much after that. You see references to evolution in nature documentaries that regurgitate the same misguided ideas that your teachers used to tell you, and your completely false idea of evolution keeps getting reinforced.

You think you know a lot about evolution because you went to university, though the reality is that you know exactly as much - or as little - as the university wanted you to know. If you meet somebody who has actually done any research into the matter and tells you something different from the standard version, you just laugh and don't even consider there might be anything to it.

But how much is the standard version actually rooted in reality? And how much does the popular version that everyone 'knows' have to do with the real version that scientists deal with in their labs? Let's have a look at a few examples of how what's being presented to us has little to do with reality and what it does to our minds and way of thinking.

The Word 'Evolve' Is Regularly Misused

evocube
Rational thinking vs. thinking
distorted by often repeated dogma

Darwinists have been so brainwashed by their religious belief in evolution that they're almost incapable of saying "this organism has this or that". Instead, they make sure to say "this organism has evolved this or that", even though there isn't a shred of evidence that any such evolution had occurred at any time. This is rather problematic, because whenever you read a text like that, you're being misled into believing that this evolution did happen and that there must be some evidence of it because the text gives you no reason to think otherwise.

Yet in almost all cases (the rare exceptions relating strictly to micro-evolution), this is simply assumed, and it's exactly the same as if the Creationists presented the sentence as "in this organism, God created this or that". (Which would, of course, make all evolutionists rabidly furious.) It is selling an assumption as fact, which is extremely unscientific and toxic to the mind. It's a lie. Most modern texts about the history of living organisms give the impression that evolution is true and proven, simply by presenting such misleading statements, and this is why many people falsely believe in evolution. They accept authoritative statements without ever checking the facts.

If you read a book promoting evolution and actually pay attention to the evidence given to you to support the theory it's presenting, you'll find that usually there's little to nothing. It just says something like "giraffes have evolved long necks" and explains how that's useful. Not a word about how the neck evolved, and no evidence that it actually did. For all we know, giraffes have had long necks since whenever giraffes started existing. Sure, we know some other species that sort of look like giraffes have shorter necks, but the only thing that proves is that there are other species that sort of look like giraffes and have shorter necks. It says absolutely nothing about the connection between the species. So saying that this long neck has 'evolved' is based on nothing but the pre-formed belief that it has. It has no connection to the truth or even to science, but that's what you get in 99% of all texts on evolution.

In most cases, the word 'evolve' should either just be dropped or, if there's evidence of a change over time actually happening, replaced with 'adapt'. We hear things like 'viruses evolve rapidly'. But what have they really 'evolved'? Are there any new genes? No. Any new organs? No. Just little workarounds around environmental problems, mostly by deleting genes and making the genome smaller and less adaptive in the long run. So a much more accurate phrase would be 'viruses adapt rapidly', or, even better, 'viruses mutate rapidly'. But no matter how much and how fast viruses mutate, they have yet to mutate into anything that's not a virus (in which case the word 'evolve' would become truly meaningful).

To put this into perspective, let's say you've had a car for 10 years. It's a bit different from what it was like 10 years ago. There are some scratches, a few things broken or damaged, some things don't work as smoothly as they used to, and nothing is as clean as when you bought it. On the other hand, the seat may be more comfortable as it's been molded to fit your body better, and there may be some quirks that happened along the way that you actually like. If we were to use Darwinian language, we would say that your car has 'evolved'. But does that really make sense? Is your car better than when you bought it? Does it have anything new and useful that you didn't add yourself? Can it do more things than in the beginning? Most likely, it can do less.

Of course if we understand 'evolution' as just any change over time, then the usage is correct (yet the informative power of such statements is next to zero, as all we learn from them is that 'things change'). But in the context of Darwin's theory, the word implies that species have 'evolved' from other species. For this, there is no evidence. If you think there is, please show us. I keep challenging people to do so, but while many have argued with my conclusions, we're all still waiting for a single piece of evidence that one species evolved into a different one.

Lenski's experiment with E. Coli is often cited as evidence of evolution. So let me show you in a simple diagram what this experiment produced:

E. Coli ---> Evolution (we are told) ---> E. Coli

Amazing, right? And this is what every single piece of 'evidence for evolution' looks like. There's not a single case that ends with something that it did not begin with. 'E. Coli' has evolved into 'E. Coli adapted to different environment' by losing parts of its genome. And that's after some 60,000 generations.

When university students and professors were asked whether they believe in evolution, they all said yes, but when pressed to provide a single example of one species evolving into a different one, nobody could come up with anything.

It's even more silly when it's said that organisms have 'evolved' a certain kind of behaviour. Why not just say they've learned something? Should we say humans have evolved making phone calls, playing chess, or staring at pictures in art galleries? Because this is what we regularly hear about pretty much everything animals do. It's like some people have trouble making a sentence about biology without the word 'evolve' embedded in it. The problem is that this inaccurate use of language leads to inaccurate thinking, distorted perspective, and wrong conclusions. The video linked above shows how strongly convinced people are that evolution is true while being unable to justify this belief in a substantial way. Where does this conviction come from? Mostly from endless repetition of things that aren't true.

To Hell with God

Of course one of the most common evolution-related misconceptions is the idea that if you're not a Darwinist/evolutionist, you must be religious. In the US, you're automatically assumed to be a Creationist because things are always slightly dumber there than anywhere else. I have never given anyone any reason to believe that I'm religious, and I've never written anything to that effect in my articles, but there's always some moron who just pops up and claims that I present a religious view or something like that. It's probably impossible to explain anything to people who exhibit that level of narrow-mindedness and/or delusion, but we can try.

Not only am I not religious, I've always disliked religion. For a long time, I downright hated Christianity. (I guess I'm more tolerant these days, and my hate is reserved for Google exclusively.) I personally think religion is stupid and people should get over it at some point. But I draw a line between religion and, for lack of a better word, spirituality, which could be described as pretty much anything that isn't materialism. Spirituality is more or less a view that there's more than just matter, and it considers consciousness a separate thing from matter, not dependent on it. Religion, on the other hand, is when you make up a lot of silly stuff, order others to believe it, and turn spirituality into dogmatic bullshit. Materialism is kind of the opposite extreme, but just as stupid as religion. Religious Creationists and materialist Darwinists are, in my view, both completely delusional, clinging to a dogma that our science and common sense should have put to sleep long ago. We would know a lot more about the history and origin of life if we had catapulted members of these two groups into outer space decades ago. They are the two greatest impediments to progress in this area.

The notion that if you're not a Darwinist, you must be religious is about as dumb as the notion that if you're not black, you must be white, as if other colours don't exist. The scientific evidence shows pretty clearly that one species can never evolve into another one, at least not by means of random mutations (a completely idiotic idea if you think about it for a few seconds), but at the same time there's no evidence that God has anything to do with it. If you find a watch in the forest, to use this well-known illustration, why the hell would your only options regarding where it came from be that either it had evolved from the naturally occurring materials in the forest or it was put there by God? Unless you're stupid, like Richard Dawkins, you can tell the watch was designed by a mind, but why would you immediately jump to the conclusion that the designer was God? Of course nobody makes that leap of faith regarding a watch, but many people do so when it comes to living organisms. I suppose some people are so limited that they cannot conceive of any other kind of intelligence than human and divine.

What's a bit startling though, is that the conclusion that if I don't believe in evolution I must think that God created living organisms, comes not so much from religious people as from defenders of Darwinism. I guess it's their way of not having to deal with the facts and evidence. If they can mark you as religious, thus in their minds 'crazy', they don't have to seriously consider what you say. If they were forced to look at the actual evidence, it would become obvious that they're the ones believing in nonsensical ideas, so they look for any excuse that allows them to just ignore you.

It's strange that people equate intelligent design with God when pretty much all (non-living) designed things that we know of were designed by humans. We could also find a few things designed by animals. Clearly, intelligence and design can be attributed to intelligence that isn't God. Of course life on Earth couldn't have been designed by any Earthlings, but why assume there couldn't have been any other intelligent (non-godly) beings in the Universe who could have put living organisms here on Earth? Can intelligent beings outside of Earth not exist because we haven't seen them? Well, we've never seen life arise out of dead matter either, yet Darwinists have no trouble believing that one! (To them, Jesus raising the dead is a ridiculous idea, but dead matter becoming alive on its own by accident is cool. And they think they're the smart ones). So what's the issue here? Why assume a religious motivation is behind any effort to dismantle the Darwinian fairy tale?

Whether there is God or not is up for debate, but I certainly don't believe in a God who listens to your prayers, puts living creatures on planets on Saturdays, and messes with everybody for petty reasons, like that shithead Yahweh. There's no evidence for such a God, and the concept makes no sense. Either way, anything that's designed or created has to come from consciousness, not matter. That's what our experience tells us. Where did this consciousness come from, then? That is certainly an interesting question, but one that may be impossible for us to answer. For all we know, consciousness has always been here, in one form or another. I mean, materialists believe matter has always been here, since the beginning of the Universe, so why not consciousness? It's not like they have any explanation for where matter came from that would make any sense. What is their theory? First there was nothing, not even time. Then, suddenly (notice that both 'then' and 'suddenly' require time), shit exploded, even though there was no shit in the first place and even though an explosion requires a trigger (when nothing existed) and time (which didn't exist), and voilà, suddenly there was all the matter there is now. Wow. Magic, anyone? This is exactly as retarded as the idea of life arising out of dead matter accidentally. Nothing about it makes any sense. And the people who believe this garbage tell me no conscious beings could have put living cells on Earth because... because what, exactly? Please.

There Is No Survival of the Fittest

womenselection

A better version of this term would be 'elimination of the least fit'. The fittest usually survive (except for accidents, murders, and other such things), but so do the somewhat less fit, and even most of the moderately fit. Depending on the species, even many of the rather unfit survive, which we can see best in the case of humans. Natural selection can eliminate the totally unfit, but it cannot effectively separate the fittest from the moderately fit, except maybe in a few species where the competition is harsh. But if natural selection only works in a few species, then it can hardly be considered the mechanism responsible for all of evolution.

What is natural selection doing about the differences in the image above? Absolutely nothing. They all survive and reproduce. Yet we're supposed to believe that a change in one nucleotide is what drives evolution because that single mutation drastically improves survival rate. If one of those women had horns or wings or a tail, her survival chances still wouldn't change significantly, and that would require hundreds to thousands of mutations. Given that large variations of all kinds persist in species, the idea that miniscule differences could drive evolution makes no sense. Fat people survive. Lazy people survive. Stupid people survive. Survival of the fittest as the driving force of evolution is a fairy tale.

And if I ask you, "Which one of the four women is likely to produce the most offspring?", you'll realise not only that there's no way for you to tell, but that it's something that doesn't even have anything to do with any kind of fitness. It's mostly a matter of the woman's decision about how many children she wants to have. And not a single one of them will have as many offspring as she can produce, which is what Darwinism claims to be the norm.

And let's not forget that to even talk about 'survival of the fittest', we have to ignore what Darwinism considers to be 'fitness', since it derives fitness from the number of offspring produced. So according to the evolutionists, the fittest survive, and the fittest are the ones who survive, so basically they're saying that those who survive are the ones who survive. And this isn't the only tautology in evolution 'science'. Yes, the theory of evolution is intellectually on the level of a four-year-old (including throwing tantrums when others disagree).

Natural Selection Cannot Create Anything

PLL1

Evolutionists have elevated natural selection to a godlike status. They sometimes (though not always) accept that mutations, being random, can't really create much of anything and instead have a rather destructive tendency, so they relegate the creative powers to natural selection. But this is a fallacy (surprise!), stemming from the desperate need to conjure up creative powers from somewhere (or rather, out of nowhere).

Natural selection can only act on what mutations produce, so with crappy raw material, there isn't much to build from. Garbage in, garbage out. If the input is random noise, the output can't be works of art. To use the example of the magic cube in the image near the top of this page - mutations do the scrambling, natural selection preserves 'good scrambles', if there happens to be such a thing, and proximity to a solved state correlates with higher chances of survival. Evolutionists believe that random mutations slowly solve the cube and selection preserves each progressively better stage. In reality, though, random mutations will never solve it in the first place, so natural selection can just helplessly watch how nothing happens. The notion of accidentally creating proteins by random mutations is like the notion of solving a 13x13x13 cube by random turning. It's only possible in fantasy novels like 'The Blind Watchmaker'.

Solving a magic cube is actually a good example of how naive the idea of 'cumulative selection' is. (Let's ignore that the term doesn't even make sense.) The cube is an example of a complex structure (the desired state requires many pieces to be in a specific configuration in relation to one another), and in order to solve all of it, some already solved parts must be first broken up in order to solve other parts, as anybody who can actually solve it will tell you. That's how complex systems work. Complexity isn't created by random accumulation of small steps. Complexity is created by coordinated accumulation of steps. It requires planning.

When solving the last layer of a 3x3x3, I usually end up with three edges needing to be switched around as the last phase of the process (image above). This requires 7 to 11 steps (turns), depending on the algorithm and counting of moves. In the middle of this algorithm, about half of the cube looks scrambled, even though I already had 51 of the 54 little squares in the right place. There's no step-by-step path to solving the cube by improving one square at a time. But that's the only way natural selection could play a role in such a process. Once I start the algorithm that actually solves the cube, all natural selection would see is a more scrambled cube. Complexity is by definition more than just accumulation of small steps one at a time. Again, it requires coordination and planning. And living creatures are the most complex things we know by far.

The process of solving the cube is similar to Darwinian evolution. Each turn is a mutation, and order increases in the process. But we can easily see that random mutations (random turns) never lead to solving the cube (you can try it), and natural selection would not only not help but actually actively prevent the cube from ever being solved, because progress requires multiple coordinated steps. And there is no evidence whatsoever to show that this is different for living organisms. The idea that every now and then, mutations produce something new, amazing, and complex is unrealistic. As I have written elsewhere, the chances of producing new genes by random mutations are practically nonexistent. And the chances that by modifying a functional gene, the gene will function better are extremely low as well. This usually only occurs when external conditions change and the organism needs to adapt to this change. This also means that the original function in its old form isn't optimal anymore, so changing the gene to something that works better under the new conditions actually becomes plausible, since there is now room for improvement. But nothing new is created on the genetic level, the mutations are very simple and few, and as far as we know, this only happens in very small (generally single-celled) organisms.

Even if an actual small advantage appears, natural selection has very little power to 'promote' this new change. The mutation can only be promoted by eliminating the non-mutants, but for this to happen, external conditions have to change drastically. (Like a new drug that kills certain bacteria.) Otherwise, why should the original organism that had been surviving just fine suddenly start dying off? The original one won't die just because a slightly improved one has appeared. Natural selection is not an active force that can push anything forward. It's not a force at all. It's just a posthumous statement that says, "This organism died before it could reproduce and thus didn't pass on its genes."

If the better variations were 'selected' and the worse ones were not, variability should always decrease. Everything should converge towards the most efficient variant. But we don't see that. We see a lot of variation. If some modifications are 'better', we can't help but observe that the inferior ones are still surviving. So natural selection isn't really sorting it out. If it did, the term 'genetic disease' would not exist.

If the biggest and strongest gorilla in the pack has the most advantage, there should soon be only big and strong individuals, and if those are the desired qualities in general, new generations should, according to the evolutionary principles, keep increasing in size and strength. Why would there be a limit? But this is clearly not happening. So not only are no new genes being produced, but even the desired qualities soon reach a threshold that they don't cross, even if it were advantageous to do so.

As I mentioned in the previous article, animal breeders know well that these limits exist. And in fact, there's an observed phenomenon described as 'return to average'. Not only does the improvement of a certain feature stop at some point, but leaving things to nature, over time the feature has a tendency to return to average values. This goes even so far that crossbreeding blind mutants at some point produces individuals who can see, even though the ability to see should have been destroyed. (This confuses and embarrasses the heck out of Darwinists, so you probably won't hear them talking about it.) So if human effort tries to push evolution 'forward', nature tends to return things back to the original design, contrary to the evolutionist belief.

Natural selection cannot create anything. It can't even take one feature over a certain threshold that seems somehow inbuilt into the organism. All it can do is 'weed out the weak', and even that doesn't work in the case of many species. If anything, natural selection tends to prevent change rather than promote it.

"If a Little Is Possible, Anything Is Possible, Given Enough Time"

If the theory of evolution can be credited with something, it's its persistence in clinging to irrational ideas that would be immediately thrown out in any other field. Regularly mixing up things mutations do with things Darwinists imagine mutations can do (but are really impossible) is unfortunately something that happens all the time. The inability of most evolutionists to understand the difference between micro-evolution and macro-evolution is mind-boggling. So is the idea that given enough time, we can extrapolate infinitely.

There are some serious limitations to what an organism can become by mutations. A horse can 'evolve' slightly longer legs, but it will never evolve legs ten metres long, even if it was useful. As I have said, things tend to return towards a size range that's natural for the species. And while a horse can mutate to be larger or smaller, or to have longer legs, harder hooves, longer mane, or bigger teeth, there's no way it can evolve wings. There's just no genetic material for that, and creating the genetic material accidentally is impossible.

The lack of realism in the ideas of evolutionists is startling. If you play with sand at the beach, we all know you can build a sand castle. But we also all know you can't build a ten metres tall oak tree with all the complex branches and leaves and everything. There are laws of physics and properties of sand that prevent that. So if we can all understand this when building things out of sand, why can't certain people understand it in the case of evolution and stubbornly insist that anything can evolve out of nothing, despite being unable to explain how?

Evolutionists imagine horses could evolve wings. After all, they believe that's what happened with dinosaurs - some of them evolved wings and became birds. But horses aren't made of plasticine. They can't start growing wings from their backs just because somebody like Richard Dawkins thinks they can. Wings don't just arise from shaping the skin on one's back in small steps. That's a completely idiotic idea. Wings require all kinds of different tissues that require very specific genes. The mutations happen on the nucleotide level, not by something changing shape externally. It's time evolutionists stopped ignoring how biology works.

The other problem with the 'given enough time' argument is that we simply don't have enough time. Even all the time in the world isn't enough to realistically create even one protein by chance. It's time evolutionists learned to understand numbers.

Extrapolating from micro-evolution to macro-evolution is like saying that if you can eat an apple, then given enough time, you could eat a whole planet. You can't, for a million reasons. Limits for what's possible do exist. Wishful thinking won't make impossible things happen. This sort of errors in thinking is, however, the hallmark of Darwinism.

Scientific Consensus, My Arse

If someone tries to convince you that a scientific theory is true by telling you there's a 'scientific consensus' or that '(all) scientists agree' on it, you know they are desperate. This argument is used when pointing to evidence is impossible or has failed. If it's impossible, it's because there is no evidence. If it has failed, it suggests there is no convincing evidence. So as a last resort, the argument that there's a 'scientific consensus' is used. But that is, of course, no argument. It's just reference to authority. It's kind of like saying, "If you don't agree with me, I'm gonna call my daddy, and he'll punch you in the face, and that will show you!" It's a childish behaviour of hiding behind authority, real or imagined, and avoiding the real issue.

Of course, as we all know, throughout history, there had been a scientific consensus on lots of things that turned out to be wrong, so it doesn't really mean anything. But not only is 'scientific consensus' not a useful argument, it doesn't even exist in this case. Just check dissentfromdarwin.org. There are many scientists, biologists in particular, who see all kinds of problems with Darwinism and evolution. If there are a thousand scientists who disagree with you, claiming that there's a scientific consensus on what you're saying is really pathetic. It shows clear disconnection from reality. And the more aggressively and deceitfully a theory has to be pushed onto the public, the less solid we find its foundations to be. Invoking 'scientific consensus' is a desperate attempt at brainwashing.

"Evolution Is a Fact"

Is it? Based on what? Based on the Authority of the Church of Darwin?

Let's do a reality check:

  • Information required for evolution is very specific. Mutations are random. Randomness doesn't produce specificity.
  • Most mutations have little to no impact on survival but degrade the genetic code.
  • Natural selection is powerless to eliminate non-mutants in most cases.
  • Complexity can't be built by point mutations (even non-random) and selection.
  • Creating new proteins randomly is virtually impossible. Evolution requires millions of them.
  • Infinitely small steps are impossible due to the need for new genes, i.e. big steps.
  • New genes require specific control regions, which requires coordination.
  • Deleterious mutations overpower beneficial ones thousands to one.
  • The fossil record doesn't support the Darwinist model at all.
  • Vertebrae form from different parts in fish and mammal embryos, refuting common ancestry. (Among many other examples)
  • Observations and experiments have only shown very basic adaptation and broken genes.
  • Mutations induced by radiation don't result in any improvement, just damage.
  • Similarity of structure is not evidence for evolution. BMW and VW didn't randomly mutate from a common ancestor either.
  • The idea that given enough time, anything is possible, is a fallacy.
  • There is exactly zero evidence that one kind of animal/plant has ever evolved into another.

If so many things show that evolution is highly improbable or even impossible, how can it be a 'fact'? Facts are not made by dogmatic claims. Facts require evidence. Nobody has ever demonstrated in any way that macro-evolution is even possible, never mind true.

Is There a Purpose or Not?

One of the truly bizarre things about Darwinism is how it treats purpose in evolution. It is very obvious in Richard Dawkins's books that while he claims that genes have no mind and no purpose, everything else he writes sounds as if he believes the opposite. If we are to truly accept that genes have no mind or goals, then nothing in Dawkins's books makes any sense. He tells us that genes manipulate organisms for their benefit, that humans or any other creatures are just tools for DNA to make more DNA, and so on. But manipulation and using tools requires intentions and goals, and there's no way to get out of this paradox. Dawkins tells us he doesn't literally mean genes are selfish, but he never tells us what exactly he does mean, and everything else he writes gives us the impression that genes truly are selfish in the usual sense of the word.

And of course it's not just Dawkins. It already started with Darwin. One of the key ideas of evolution by natural selection is that everything is accidental and there's no purpose, but every Darwinian explanation of biological facts betrays this idea. This was brought home in David Stove's book Darwinian Fairytales. He shows with painful meticulousness, looking at the issue from every possible angle, that the core Darwinian ideas are incoherent, inconsistent, and contradictory. He also points to the fact that nobody has even tried to explain this glaring inconsistency. He shows that while many have said or implied, "Well, we don't really mean that literally", when they speak of 'selfish genes', 'manipulative genes', or adaptation for a specific purpose, nobody has ever explained what they all do mean by what they say.

This is a serious problem for the theory, because once you think about this a bit more, you can't help but wonder, "What is it that they're actually saying?" And there doesn't seem to be any satisfactory answer forthcoming. If adaptations are for a purpose, if genes manipulate us for their selfish goals, in any intelligible sense of the words, then genes are apparently all-powerful invisible beings, suspiciously similar to gods, and Darwinism is basically a religion that ascribes all purpose of life to these invisible beings. But if, on the other hand, this is not the case and DNA is just a dead molecule that can't make anybody do anything, then no Darwinian explanations make any sense. When Darwinists talk about ingenious adaptations, they're hinting at intelligence, which, in the same breath, they vehemently deny. If they don't mean what they say, what do they mean? Nobody seems to have an answer.

The result of this is pretty tragic. What we're seeing in evolutionary 'education' is:

  1. people being told there's no purpose in anything,
  2. people being given explanations that are teeming with purpose, and
  3. people being brainwashed into believing that both are true at the same time and there's no contradiction.

This literally makes you stupid. If you can digest Darwinian evolution without strong feelings of cognitive dissonance, something is already broken in your head.

If even just surviving and reproducing is something organisms strive for, as we often hear, then there is a goal, a purpose, a meaning. But where could it come from when the same people who tell us this insist that genes have no mind and organisms themselves are mere slaves of their genes? And this of course just restates the contradiction because how can you be a slave of something that has no mind, no goal, and is completely accidental?

If we are serious about the idea that genes are really not conscious agents and have no mind or goals, and that all adaptation is completely accidental and without purpose, then there can be no struggle for life, no manipulation by genes, no selfishness, and no need for surviving or reproducing whatsoever. There cannot possibly be any reason for genes to replicate, much less a need for it. A gene itself does not benefit in any way from making a copy of itself, despite all evolutionary literature implying that it does. The fallacy that it does is so widespread that most people accept it without thinking. But it is utterly nonsensical. Replication cannot be 'good' or 'bad' for the gene because that would imply the gene can appreciate that. The gene has no such ability, even according to Darwinians. There is no more pressure for a gene to reproduce than there is pressure for a calculator to give you the right result when you type 6+6=. It's just what they're programmed to do, and they do not and by definition can not care about the result.

But if that's the case, then everything written in Richard Dawkins's books (and pretty much all Darwinian literature) is complete rubbish, not only because it's stupid on its own, but also because it's inconsistent with the Darwinian claim that genes have no minds or goals. The Darwinists have, with considerable pride and sense of accomplishment, taken consciousness and intelligence out of the equation, never quite realising that they have no means left to explain purpose. At the same time it is clear that they do feel that purpose is evident all around us. So for 160 years, they have held two contradictory beliefs and pretended like they've solved all the mysteries of the universe. Genes are selfish, except they aren't, because they don't have a mind. Genes manipulate us, except they can't, because they have no intelligence. Genes only care about replicating themselves, except they don't, because they can't have any goals. Genes struggle against other genes or alleles, except they don't, because they can't possibly have any sort of awareness of anything. And so on ad absurdum.

What does this tell us about all the people who went through school, accepted evolution by natural selection as fact, and either haven't noticed or don't care about the omnipresent contradictions? It doesn't speak highly of their ability to think. Of course, the truth is that most of them have not really thought about it much. This would be fine if it wasn't for the fact that they do strongly believe in all this nonsense and look down on those who don't. The conviction is highly disproportionate to their actual knowledge. It is ironic that the evolutionary literature is plagued by the same problems as the Bible - belief in invisible beings who manipulate us all, endless contradictions, and a ton of illogical nonsense - when the evolutionists are one of the chief groups that accuse Christians of not being able to solve exactly these problems.

The mere idea that survival and reproduction are the 'goals' of life is rendered impossible by Darwinism's own premises. There is nothing to have goals. In fact, if we are to take Darwinian materialist principles seriously, there is hardly anything that can be called 'life' at all. Darwinian life is dead. DNA isn't alive. Consciousness is allegedly only a side effect of some random mutations. There is no independent consciousness that could have any goals, and thus there cannot possibly be any goals, including survival. In fact, many, if not most, living organisms don't posses any consciousness of any kind, according to Darwinism, yet at the same time we're told they do have the goal of reproducing. What part of them has this goal, I ask? Darwinism is at its very core so contradictory that it's impressive anyone can swallow it without vomiting.

The whole evolutionary story only works through personification of genes, yet we are assured genes posses no awareness or mind whatsoever. It's like a religion of a dead god. The god is dead, but he still makes you behave according to his wishes, even though he has no wishes... but he does it anyway. Kind of accidentally. But you still have to obey. Even though he's dead. Because you don't have a choice. For some reason. Yep. That's right. You are but a servant of He Who Doesn't Exist. And you'd better reproduce soon if you don't want his non-existent mind to be very angry with you. I know, this is a difficult cult to be in, but please try to keep up.

Implications

What are the implications of all this? Think about it. Living creatures, including ourselves and other people, are a major part of our lives. But what do we really know about them and where they came from? Since childhood, we're being told an elaborate lie, including plenty of information that's actually known to be false (see Jonathan Wells's book Zombie Science) even by Darwinists. Along with this lie comes a whole world-view. The view that there's only matter, everything is mechanical and random, all life is an accident, your mind is only an illusion, and there's no meaning in anything. You are taught to see the world that way. Does it matter? You decide. But let's look at where it should logically lead.

How to Be a Consistent Darwinist

If you believe that Darwinism is right and evolution by natural selection is true, here's what your life should look like. If it doesn't, then you don't really believe in evolution, or you're just doing everything wrong. If you believe in evolution, you should be consistent about it. You can't claim you believe in it but act as if you don't. So here's what Neo-Darwinism looks like when we don't drop it whenever it becomes inconvenient.

You are just a sack of meat and bones, made of unconscious atoms and molecules that over billions of years took the shape you currently have, completely accidentally. Your ancestor is a single-celled bacterium. You're just the result of a long series of mistakes in this bacterium's DNA replication process. Your mind is an illusion. Your perception is just the result of firing neurons, directed by your genes. Your genes are strings of molecules made of carbon, oxygen, hydrogen, nitrogen, and phosphorus with the sum IQ of zero. Yet they 'decide' everything you do. You don't actually make any choices. You have no free will because no such thing as will exists. It's an illusion. Everything you do is the only thing you can do at that point, determined by your genes and environment.

Your genes may have no mind, but that doesn't stop them from manipulating you all your life. (This contradiction doesn't bother you at all, because your genes have manipulated you into not thinking about it.) You are a slave of your DNA, and your purpose is to make more such DNA. You are truly a pitiful creature because everything you do is controlled by something that has no awareness of you (or of anything else).

Your wife/husband/child is also a sack of meat with no real mind, no intelligence, and no free will, and there's no meaning in their existence. Your relationship is determined by hormones and firing neurons, directed by 'selfish' genes. How your life will turn out is not up to you. You're not in the driver's seat. You're just a spectator, watching what your genes are making you do, and you probably mistakenly believe that you're actually making your own choices. You're not. Not if Darwinian evolution is true. You have no control over your life and existence whatsoever. There's hardly any 'you' in the first place.

The religious people you know aren't stupid. The criminals you know are not 'bad'. There are no such things. Everything is just a survival strategy, an adaptation to the environment, driven by genes. If a person is surviving and reproducing, they're adapting to their environment well. If they survive by murdering and reproduce by raping, it's all good because survival is all that matters and it's their genes that make them behave this way. They don't have a choice in that matter, just like you don't have any choice in anything. Morality doesn't exist because there's no place for such a concept in the context of evolution by natural selection. Raping and murdering aren't 'bad behaviour', except in your delusions. They are a survival strategy, and if they work, they're as close to 'good' as you can get. You can't turn away from these inevitable conclusions.

If you believe in Neo-Darwinian evolution by natural selection, you believe that life originated when atoms accidentally bumped into each other in a randomly specific (an oxymoron if there ever was one) order. You believe accidental replacements of Adenine with Cytosine or Thymine are responsible for a fish changing into a bear. You believe all creatures have a common ancestor, and you believe there's evidence for that, even though there isn't. Strangely, though, you believe whatever you believe not because you think about it but because your genes somehow make you believe that, even though nobody knows why (or how). It is unclear why evolution makes some people believe in God and turns others into atheists. But if you survive, it doesn't matter what you believe. Truth has no value, after all. If you survive through lying, you're clearly doing it right. If you die for the truth, you're an evolutionary failure.

Every day, you get up and go to work because that's what your genes want you to do. You kiss your wife/husband not because you love them (love doesn't exist - it's only a delusion), but because it's your genes' survival strategy, just like everything else you do. Survival is all that matters. If your neighbour has more children than you, he/she is a more successful specimen than you, evolution-wise. If you spend your time studying or helping others while your friend spends his time having sex and producing lots of offspring, then his genes are better than your crappy ones, because the quality of genes is determined by the number of offspring. He is the future of mankind. You are a mistake.

You will spend the rest of your meaningless life in whatever way your genes dictate. You've read this article because your genes made you do it. If you leave a comment disagreeing with the article, it's your genes making you do that. If writing your comment doesn't produce any offspring, it's 100% pointless. Anything else you do that doesn't produce offspring has no value whatsoever. If all else is meaningless, what's the point of surviving and reproducing? Hell if I know. Ask your genes.

If you believe in evolution by random mutations and natural selection, then this should unavoidably be your view of life, Universe, and everything. If it isn't, then you're a hypocrite, changing beliefs based on what's convenient at the moment.

Part 8 ♦ Natural Selection - The Jesus of Evolution  [Source]
satangoat
Two horns weren't good enough for
survival, so natural selection made
two more. Twice as many horns =
twice as many offspring. However,
a competing, equally ridiculous
theory says these were a gift from
Satan, whom these goats worship.

Listening to promoters of evolution, like Richard Dawkins, you get the feeling that natural selection is something utterly amazing, on par with Jesus. It's this magical thing that sorts through random mutations, separates the good ones from the bad ones, lets the bad ones disappear, and 'selects for' the good ones, and we get cool new life forms. Whatever living things exist, and many are amazing, to be sure, we're told that natural selection 'made' them. It gave us giraffes and birds and chameleons. But of course, this only makes sense if you don't actually think about it for a few minutes.

Can natural selection (NS) really make things? How would it do that? What power does it really possess? Let's reduce it to the simplest question - what really is natural selection?

"If something manages to reproduce, it passes on its genes to the next generation. Otherwise, not."

That. That's it. That's all of natural selection. It's not a force of any kind. It doesn't "do" anything. It's a passive process, or rather, a commentary on something that has happened. Basically all it says is that whatever survives, survives. Well, no shit, Sherlock. We kinda knew that.

So while it's often talked about as if it was the Jesus of Evolution, it's really nothing much. It doesn't do anything; it doesn't make anything. It just sits on the sidelines and says things like, "Oh look, this guy with the new mutation just had a baby. Oh, that other guy without the mutation also just had a baby. Weird." There's no 'select for' button. (Though if you read Dawkins's books, you might well think there is.)

So how did NS get its almost godly status? Well, the theory that stupid, dead atoms just randomly assemble into better and better things couldn't fool anyone for long, so something godly had to be introduced. Random mutations are random and thus follow the rules of entropy and make things worse, so the only other candidate was NS. I mean, we see all these amazing things around us, and we've decided that they have evolved from less amazing things, and any intelligent input is strictly forbidden, so it must be NS doing that. That's the general idea.

NS turned out to be a great tool because most people can't really imagine what it is, so evolutionists use it as a personification of a godlike force that can do just about anything, and for most people the concept is too vague to find any particular flaws with it. So it was established that NS gets rid of all these deleterious mutations, of which there are plenty, and that it 'selects for' the occasional, rare, beneficial ones. Make sense? If you said yes, then you haven't really thought about it.

turtle
This turtle evolved spikes to prevent
other animals from sitting on it,
which was always slowing it down. Its
offspring production has skyrocketed
since. Other kinds of turtles
apparently never had this problem.

In order to determine how these mutations can affect the whole species, we need to understand the nature of mutations better. Firstly, the deleterious ones outnumber the beneficial ones thousands to one, so mostly we get the negative ones, pretty much all the time. If they kill the organism before it reproduces, the mutations are stopped dead in their tracks. And that's about the only time anything significant happens according to the rules of NS. The mutated gene was bad, creature died, mutated gene's gone, species continues as it was.

So what if a beneficial one appears? Well, first of all, we need to understand that any mutation is so small that its effects, especially the positive ones, are unlikely to even be visible. The negative ones can be, because one little bad change can screw up everything. One wrong nucleotide can result in a nonfunctional protein, which then fails to perform a function necessary for life, and the organisms dies. In fact, most so-called "positive" mutations are actually ones that break an existing gene, which ends up having an unanticipated positive effect, kind of like your passenger car seat falling out the side door, resulting in better gas mileage.

But what can one positive mutation really do, one that actually improves on an existing function? Even some bacteria have millions of nucleotides. Humans have three billion. So imagine an aeroplane that has millions of parts. You can guess that breaking one vital part can be deadly. But how could one small modification of one part out of millions make the whole noticeably better? If you make one tiny change to a plane, will anyone be able to tell that this plane is better than the other ones? Will the passengers say, "Oh, the flight was great today. This plane is much better than the one I flew with last time"?

In biology, the selection is supposed to be determined by survival rate. So the organisms with the mutation must survive a lot more than the others, on average, so that the mutation can spread in the population. But again, while a single mistake can have the power to kill off the whole organism, can a single small improvement to one part out of millions make the organism survive significantly more often that those without the mutation? In case of the plane, how could we modify one single part of the plane in a simple manner so that it functions significantly better than the other planes, to the point that the company can notice this and decide to make these new planes and not the old ones anymore?

You can probably imagine that this would be rather difficult. Even if a small improvement is made, the old planes still work like they always have. Now, planes don't reproduce, but there's a reasonable analogy here. For a mutation to become widespread, the mutants have to survive much more easily than the non-mutants, or the non-mutants have to start dying out for some reason. If a plane is slightly improved, we could theoretically dump the old planes and start making new ones, but the cost of dumping functional planes would be so high that obviously they'll keep flying for a long time, basically as long as they can. And just like a replacement of a plane won't happen quickly, it won't with organisms either. Just like the old planes still perform the job just fine, so do the non-mutant organisms, and so they survive at about the same rate as the mutants.

Add to this the fact that the first mutant, despite some very small advantage, is just as prone to all kinds of dangers, from accidents to predators, that it may well die before the new gene even gets passed on at all. Just because this mutation is beneficial doesn't mean the organism has to survive. As long as there are only a few of the mutants, they're much more susceptible to being wiped out by a random disaster than the more numerous general population without the mutation. A beneficial mutation doesn't prevent an organism from dying by any number of means. NS cannot 'do' anything. It's not something that can take action. It's something that just 'happens'.

And this was the best case scenario - a mutation that's beneficial and at least slightly visible. Most aren't visible.

mutations

At right is a graph of a realistic distribution of mutations. Deleterious ones are on the left, beneficial ones on the right. As you can see, the beneficials are rare, and they're actually exaggerated many times in the graph. The small triangle to the right of "0" should really be so small that you wouldn't even see it, but then... you couldn't see it, so it's magnified. The mutations at "0" are neutral, i.e. they don't affect the organism in any way. (If you're curious how this is possible, consider that usually several codons code for the same amino acid. For example, CCU, CCC, CCA, and CCG all code for Proline. So the last of the three nucleotides can mutate into any of the 3 other letters without affecting the outcome. And this is just one example of a neutral mutation.)

So we can see that most mutations are on the negative side, close to being neutral. We call them near-neutral mutations. They don't improve anything and cause very slight and/or occasional damage, but it's not significant enough to affect the organism's survival rate. People survive and reproduce even with pretty bad genetic defects, which can involve many mutations, so one small mutation that does a little damage somewhere won't be visible on the level of the whole organism. It may just cause the production of certain chemicals to be slow.

If you're wondering about how such things would affect you, think about cases such as you getting out of breath a bit quicker than others while running, or having a bit of a trouble falling asleep, or handling cold weather worse than others, or bruising more easily, or being unable to digest certain proteins, or being bad at mathematics because your neurons fire less efficiently, and so on. It's clear that these things are detrimental and make you 'worse' rather than 'better', but you can just as easily see that none of this even remotely prevents you from surviving or having children.

This means that while you - and all the rest of us - are suffering from any number of small defects, NS is blind to them because you still survive and have children, and your slightly defective genes get passed on to the next generation. Such mutations are in the 'No Selection Zone' in the picture. This is a zone where the mutations aren't significant enough to change your survival rate compared to others around you. And the zone works just as well for the beneficial mutations.

Think of the people who are somehow slightly 'better' than the rest of us in some way. The fastest runners, best fighters, smartest scientists, and so on. Does NS 'select for them' and over time create a population of fast runners and smart scientists? Clearly not. The incidence of such people in the population over time is still about the same. These characteristics give them some advantage, but don't make them reproduce more than the rest of the population. So we can see that even fairly significant advantages have little to no impact on survival and reproduction. Plus a smart scientist can be fat and lazy and sick, and the fastest runner can be totally dumb, which gets us to another point.

Since detrimental near-neutrals are the most common and invisible, they keep accumulating in the genome over time. So when you actually get a beneficial mutation, you already have hundreds or thousands of detrimental near-neutrals in your genes. So any improvement comes along with a baggage of detriments. Mutation happens at the level of nucleotides; NS happens at the level of the whole organism. There's no way to let only a part of your genome survive. And along with the near-neutrals, you may easily pick up a few not so neutral ones.

For example you may be a really smart scientist, maybe a Nobel Prize scientific material, but have a serious genetic disease that complicates your life somehow. So what will happen with regard to NS? Well, either you have children and pass on both the benefits and problems, or you don't. There's no way to separate one from the other. And if you pass on both, then over time, things only tend to get worse because negative mutations always accumulate much faster.

So any slow accumulation of beneficial mutations will always be accompanied by a rather fast accumulation of detrimental ones. Whatever benefit you acquire may easily get 'broken' in the future, but any damage you acquire is very unlikely to get fixed. So if you get one plus and one minus and pass them on, the future generations are thousands of times more likely to lose the plus than get rid of the minus. This is entirely logical if you think about entropy.

spider
Millions of years ago: "Oh what the hell?!
What is this sticky thing suddenly coming
out of my butt? Am I evolving again?
Jesus Christ, what am I supposed to
do with this?" (...Because first you get
a mutation for producing the material
and only millions of years later you
get another one for knowing how
to make a web.)

It should be becoming clear that even when beneficial mutations appear now and then, the genome tends to degrade overall anyway, and natural selection can't reverse that. It has no power, no means to change that outcome. When you look at the distribution of mutations again, you see that the vast majority of all mutations are a) detrimental AND b) invisible to NS. This means that every organism keeps acquiring these all the time. The damage is slowly increasing in small steps, which is perfectly in line with entropy, but perfectly opposed to the idea of evolution. Things do not get progressively better. They actually tend to get progressively worse. The main effect of NS is not 'selecting for' anything, but eliminating the really bad damage, in the sense that whatever mutations kill the organism before reproductive age are prevented from propagating.

So where did anyone even get the idea that NS can create something good? Save for the delusional fantasies of Richard Dawkins, this notion mainly comes from what we see in very small organisms like bacteria. A bacterium is infecting humans, humans make a drug to kill the bacteria, bacteria are dying until one of them develops resistance to the drug through mutations, mutants survive while non-mutants die, and the bacterium has 'evolved' through NS (if you can call a man-made drug natural, which is debatable). Now, this does happen, but it's opening a can of worms, so we need to slow down and look closely at what's really going on here and why.

Probably the most important element we need to notice here is the environmental factor. The mutants live while the non-mutants die. Why? I said before that NS would have no power to 'select for' the mutants. The difference here is that the environment had changed. We're not talking about bacteria living their usual life. We're talking about bacteria in crisis, dying off because of a drug. So the thing that causes the huge difference in survival rate between the mutants and non-mutants is a new external factor, a drug that's literally killing off the non-mutants. And this is about the only condition under which such a separation can happen. (And again, this drug is not a natural occurrence but a product of design, something supposedly nonexistent until the appearance of humans.)

If a certain fox develops a small beneficial mutation, normally it won't make any difference for all the other foxes, and NS will have nothing to do. Only when a changed condition starts killing off the non-mutant foxes will there be a significant difference in survival rates. So it's important to realise that this whole idea of NS 'selecting for' something comes from a case where external conditions had drastically changed (by design, with the actual intention of eradicating the bacteria) and is extrapolated to apply in general, which is highly unreasonable for reasons explained. This kind of mutation could only have an impact on larger animals during some widespread plagues. Under normal conditions, a small improvement in a mutant will have no impact on anything. So we could almost say that evolution by natural selection only works under unnatural conditions.

hellfrog
Spikeless ancestors of frogs couldn't
compete with the evolved spiked frogs,
so they died out. Wait, no, they didn't...
What the hell?

For evolution by NS to be true, trillions of mutations would have had to occur in the course of history. But for each of them to spread efficiently in the population, there would have to be a significant crisis for the non-mutants, so history would have to consist of one disaster after another, on a scale difficult to even imagine, never mind supported by any evidence. The 'selective pressure' that evolutionists like to talk about so much doesn't exist 99.99% of the time. And even when it does, it is extremely unlikely that a single mutation will make a huge difference in an organism much larger than one cell.

But that's not the only thing that separates bacteria from large organisms. There are several reasons why this kind of thing will be thousands of times more efficient in bacteria or viruses than in anything else. First of all, single-celled organisms mutate orders of magnitude faster than large organisms. This is logical. Short generation spans mean that instead of once every few years, you get a new generation with new mutations several times a day, plus there are far more specimens of bacteria than of larger organisms. Bacteria go through as many mutations in a few decades as many mammals have gone in their whole existence on Earth. So it's not reasonable to expect that what we see in the bacteria's resistance to drugs is even applicable to pines or bears. If it takes a few weeks for the bacteria to hit upon the right mutation to resist the drug (meaning hundreds to thousands of generations), it would take bears hundreds to thousands of years. But by that time, any plague would long have killed them off and be gone.

This is an important point. Bacteria is where most of any useful effects of mutations and selection have been observed, but it is also where the mechanism has thousands of times greater power than anywhere else. Extrapolating that this is how all species evolve is irrational.

There is a second important point here as well, though. Not only do bacteria mutate much faster, but the mutations also have a far stronger effect than in larger organisms. The drug resistance often results from only a single mutation. Now think about the difference between a single mutation in a bacterium and in a bear. In the bacterium, one nucleotide out of maybe a million has changed and has only one cell to affect. In a bear, one nucleotide out of maybe a billion has changed and has a creature of trillions of cells to affect.

The effect of a single mutation will be the strongest in the smallest of organisms, namely viruses and bacteria. In a larger organism, the mutation is likely to affect only a certain type of cells, like red blood cells or kidney cells. In bacteria, it affects the only cell there is, which is the whole organism. If a thousand cells die because of a mutation in a bear, the bear is probably fine. If one cell dies in a bacterium, the bacterium is dead. So mutations affect bacteria not only much faster, but also much more strongly. And again, biologists extrapolate from what they see in bacteria to all organisms, not taking into consideration that there's a completely different context.

It's true that the logic of "what happens in bacteria in days can still happen in bears in centuries, and evolution is slow" makes sense to some extent. But all creatures live in (more or less) the same environment, here on Earth. So think of it this way: The fast-mutating bacteria are fighting slowly-adapting human scientists. The slowly-mutating bears are likely to be fighting those fast-adapting bacteria and viruses. So not only do the bears need a lot more time, but they're actually fighting something that's a million times faster than them at adapting. So we cannot just say that if the bacteria can do something in a week, bears could do it in a century. There is a different context for each of them.

Keep in mind that we haven't observed any kind of evolution directly in anything other than the smallest of organisms, which, as I have explained, are actually much more likely to undergo such changes than any other organisms, even considering prolonged time scales for the large organisms. So how reasonable is it to judge how large animals evolve from what we see in bacteria? Let's recapitulate:

  1. New mutations can spread efficiently only when an external agent is killing off the non-mutants en masse.
  2. Single-celled organisms mutate thousands or millions of times faster than larger ones.
  3. Single-celled organisms are likely to be affected much more strongly than larger ones by small mutations.
  4. Environmental factors have more or less the same speed for everyone, so while bacteria will likely come across a useful mutation in time, larger organisms will likely die long before any such mutation occurs.

These points show that mutations and selection do have fairly strong effects in bacteria and viruses, but they also show that it's because those are single-celled organisms that things actually work this well. It is very short-sighted to suggest that all organisms have evolved by this same mechanism. There is no reason to expect this to work on a large scale.

gears
If you can explain how natural selection
'made' the Planthopper's gears from
one random mutation at a time, over
millions of years, please tell us.

Another very important thing worth noting is that these small organisms have never 'evolved' anything complex or really new. No new genes, no new organs, they never change from single-celled to multi-celled, and their basic structure is still exactly the same, even after millions of generations with billions of specimens. Most of the mutations that we've seen make a difference are single mutations, and at best we see two or three mutations working together. Which is about as much as we can expect when we do the math. With increasing complexity, the probability of success drops exponentially.

So there's a paradox here: If there is environmental pressure, then what we get is quick hacks and a net loss of genetic information, rather than anything new and complex, and if there isn't any environmental pressure, then there is no opportunity to evolve new things.

When we put together all the single-celled organisms on this planet, they have undergone more mutations just in our lifetime than humans or any other mammals have in all of their existence. But none of them have evolved into a multi-celled organism, none of them have produced a single new gene from scratch, and none have changed into a different species. Yet supposedly mammals, in whom mutations would have a much smaller effect, have transformed from one species into another? What reason is there to believe that?

The number of generations and specimens involved in the supposed evolution from monkeys to humans occurs in bacteria on the order of decades, yet they have zero new genes to show for it. So if we were to extrapolate from bacteria's evolutionary achievements to mammals based on science and not fantasy, the conclusion would have to be that any significant evolution is extremely unlikely at best, even with 100 billion years.

kang
The kangaroo's pocket evolved very
slowly. First it was so small that
the kangaroo could only carry little
items like a pen or a lighter.
After millions of years, it evolved to
carry little kangaroos, which was vital
for their survival. How they survived
before they had pockets is unclear.

Yet another fact is that even most of those mutations that create drug resistance or somehow increase survival in similar situations are still detrimental in a genetic sense (as opposed to in the sense of survival). Most of these adaptations actually happen by breaking genes, rather than by evolving something new or at least being genetically neutral. Often the bacterium gains an immediate advantage by throwing away something that would have been beneficial in the long run.

So not only does NS have little if any power in selecting, but it is also extremely short-sighted. Whatever quick hack will ensure survival right now is what will be passed on to the next generation. NS doesn't care if other things get broken, as long as immediate survival is ensured. And that's what usually happens - something specific is changed to ensure survival at the cost of breaking something else.

For example a bacterium may be able to metabolise different kinds of sugars. While getting a mutation that induces drug resistance, the gene for metabolising one sugar may be broken. As long as another sugar is available, NS doesn't care that the organism has lost a useful ability. But in the long run, a part of the genome has been lost for a single mutation that happened to provide drug resistance, and it will never come back. The genome again degrades over time. Calling this evolution is somewhat misleading, to say the least.

So instead of saying, "If bacteria can do this in 30 years, surely fish can evolve into bears in 500 million years", we should be asking ourselves, "If bacteria can only come up with 2-3 mutations together at most and never evolve anything complex while breaking many functional things, why would we expect that more complicated organisms would do any better?" The results are rather poor in single-celled organisms when looking at the big picture, and NS has far less power in larger organisms. And it should be noted that for anything significant to 'evolve', thousands of improbable mutations would have to pile up in a useful manner, and we've seen that it is difficult for even one to be established in the population.

panda
"Hi, I am Panda. I have evolved to
spend half of each day munching
on bamboo because it helps
me produce lots of little pandas.
That's why you see them everywhere."

Let us look realistically at the idea that the giraffe's neck has evolved by NS (for which there is zero evidence). The theory is that this happened one mutation at a time. But by how much can one mutation make the neck longer? Enough so that it increases survival rate? Will a giraffe with a 10 cm longer neck survive where another one will die? Hardly, given that 10 cm is well within the natural variation among specimens.

So what, one mutation made the neck half a metre longer? That certainly seems ridiculous, but this amount of difference would also need at least some of those changes in the giraffe's blood circulation that ensure that its head doesn't explode every time it drinks. And this illustrates the ever-present problem of evolution - a change too small has no visible effect and is unselectable, and a change too large cannot happen by a single mutation and is thus impossible.

How large a change actually affects survival and reproduction? This simple question, when explored even superficially, shows the lack of realism in evolutionary explanations regarding NS. It is easy to see that differences between two individuals involving hundreds of changes have no impact on survival rate. The natural variation of characteristics in many species is quite large. Size differences of 30% are not uncommon. And since they're not disappearing, they clearly don't affect survival rate.

A missing finger (or an extra finger) doesn't affect survival rate, but that's a larger change than the vast majority of mutations can produce. Even one eye missing is nowhere near ensuring that such a specimen won't be able to reproduce. Animals with a cut-off tail have generally no trouble surviving, but according to the evolutionists, this tail could only have evolved under selective 'pressure', meaning the animals without it couldn't survive next to the ones with it. It shouldn't be hard to see that this doesn't make any sense.

What exactly are those mutations that are so small that you can't see them but so significant that those who don't have them die much faster than those who do? Can anyone show me such mutations in multi-celled organisms? Can anyone show me a mutation of one nucleotide in an animal that visibly increases the survival rate of the mutants compared to the non-mutants? When I put the question like that, does anyone actually believe such a thing exists?

caterpillar
Whatever's going on here is
absolutely essential for survival
(or helps produce more offspring).
Otherwise it couldn't have evolved.

So what can and what can not happen as a result of natural selection? The key appears to be the difference between changes in existing variation and appearance of new features. Small modifications of what already exists are certainly possible. Creation of completely new structures (new organs, new genes) is still undocumented and unobserved, after 160 years of searching and bragging about how awesome evolution is. Dog breeding shows selection (by design) from existing variation, with clearly observable limits to how far these changes can go. But evolution would need to go way beyond these limits, way beyond changes in existing variation. It would have to produce variation that didn't exist before.

For all the variation that we see around us to appear in the first place, some kind of consistent massive input of information over the course of billions of years is needed. An input that NS cannot provide, and neither can random mutations. Random mutations won't produce a new organ any more than glitches in a computer will produce a new program. And if random mutations don't produce the raw material, NS has nothing to build from, even if it had the ability.

But there's much more that speaks against NS being an effective evolutionary tool. For example, lots of organisms have a complex social structure where the survival of individuals is tightly connected to the survival of the whole group. So if one individual has a new mutation, NS can't do anything about it if the group acts as a whole. How would one ant have a better survival chance than the other ants? What about animals that hunt in groups? One catches prey, and they all eat. Where's the selection?

If a whale swallows ten thousand shrimp in one bite, did the slightly genetically improved shrimp escape? If a tornado destroys everything in its path, do the most genetically fit animals survive? If a river gets poisoned, how are the animals drinking from it selected for survival based on mutations? If an area becomes devoid of food, it is no good that a specific individual is 'evolving' better lungs, even if that was possible in the first place (which, judging by the evidence, it isn't). It is extremely difficult for any efficient 'selection' to occur, and many environmental and other factors affect everyone the same, ignoring genetics.

And then there's of course the case of humans, the ultimate species to prove that NS is almost completely impotent. Even the stupidest, slowest, laziest, and most incompetent of humans are perfectly capable of having sex and producing offspring. In fact, because they're stupid, they often do a lot of that, because they don't really know how to do much else, which was so nicely depicted in the movie Idiocracy.

gorgon
This animal failed to evolve appropriate
camouflage, so instead it has evolved
a stare that turns you to stone.

It is also interesting to reflect on how the idea of NS has led to many stupid ideologies, culminating with Hitler's Nazism. What's really interesting about it is that these ideologies were meant to 'help' natural selection because it was observed that NS wasn't really working. Hitler decided that Aryans were cool and Jews were lame, and because NS wasn't taking care of it, he created the other NS, National Socialism, to 'fix' that problem.

But it wasn't only Jews that some parts of the society wanted to get rid of at various points. It was also people like cripples. You know, the people who, if NS worked properly, should have been eliminated naturally. But clearly that wasn't happening. In the end, both Darwin's NS and Hitler's NS turned out to be failures in terms of achieving the required goals.

Just like the Biblical Jesus is based on a real person (or several) but is largely made up, so natural selection, as seen by Darwinists, is based on a real process but largely made up. Macroevolution by natural selection is a story, just like Jesus walking on water. Neither walking on water nor evolution of a new organ has ever been observed, and both violate established scientific principles. Based on our real-life experience, gravity or entropy don't just disappear when we wish so. Natural selection exists, but just like Jesus, it can't 'perform miracles', which is what's required for the Darwinian model to be true.

So the next time you hear some smartass tell you that natural selection has created this or that amazing creature, demand a realistic explanation of how exactly that happened, as opposed to the implied "natural selection waved its magic wand, and there it was".

Scientists: Since DNA is the software of life, how can you
have its incredibly complex programming without a programmer?  [Source]

Douglas Axe
Douglas Axe, in a scene from Science
Uprising, “DNA: The Programmer.”

Two remarkable advances in science together sealed the doom of any materialist evolutionary theory. They are the development of computer software, and the discovery that digital code lies at the foundation of life. That's the theme of the new third episode of Science Uprising, "DNA: The Programmer."

You'd have to be pretty insensitive to watch these six minutes through to the end without getting goosebumps, even if the information argument developed by Douglas Axe, Stephen Meyer, and other design theorists is already familiar to you:

Atheists Craig Venter and Richard Dawkins are famed scientists who freely agree on the analogy between software and genetic coding. Microsoft's Bill Gates, who ought to know, ups the ante by noting that DNA stands as a far more impressive instance of coding than the software that humans are able to devise. As Stephen Meyer says here, we know from having lived in and observed the world that "information always arises from an intelligent source." Simply applying that knowledge to the biological information in DNA seems to command an inference to intelligent design.

Hidden in the Milky Way

We also know, as Meyer points out, that "random changes in a section of functional code or functional information is going to degrade that information long before you get to something fundamentally new. That's the problem with the mutation-selection mechanism as an explanation for new genetic information." To describe the difficulty of evolving a functional protein, Douglas Axe, the Caltech-trained chemical engineer, draws a striking comparison to seeking out - blindfolded! - a particular atom secreted away somewhere in the Milky Way.

"So here's the question," asks the masked narrator of Science Uprising: "If our DNA code is more complex than any manmade software, where did it come from? Is it possible it was authored without an author? Programmed without a programmer?" Materialists are forced back to such a conclusion, which common sense, or what Dr. Axe has called "common science," tells us is absurd.

The episode also briefly sketches those most precious things in humans experience whose value our culture's reigning materialism would have us deny. There's a lot at stake. Please do consider sharing it widely.

Why Darwinism Is Wrong, Dead Wrong
Part 1: Intelligent Design and Information  [Source]
Darwin statue
Charles Darwin: God-savior of materialism

Despite its name, Darwin's theory of evolution - and its post-genetics variation, neo-Darwinism - is almost universally accepted as hard fact. It's 'scientifically proven' we're told, which in practice simply denotes something about which you are not allowed to ask questions. But Darwinism is wrong, dead wrong. It is wrong philosophically, scientifically and morally.

  • It is philosophically wrong, because even some non-sloppy thinking combined with common sense is all you need to dismiss it.
  • It is scientifically wrong, because the more science progresses (the more we discover about molecular biology, for example), the more Darwinism loses the little plausibility it had left.
  • It is morally wrong, because the kind of materialism and (false) postulations about nature Darwinism promotes imply an abhorrent world view that acts like poison on human morality; as such, it paved the way for Nazism, Stalinism, postmodernism and today's nihilist, almost psychopathic outlook on life in general.

In the first part of this series, we'll look at Darwin's theory from the philosophical angle. Philosophy promotes rigorous thinking, the detection of gross errors in reasoning and the ability to hold different and conflicting ideas in mind without freaking out. Let's see how Darwinism fares.

Darwin's Arch-Enemy: Intelligent Design

Darwinism is a mess. It makes all kinds of wild assumptions that are seldom even brought to conscious awareness, and those defending Darwinism often play games with definitions and the meanings of words. So instead of tackling Darwinism head-on, let's first consider it in the context of another theory that Darwinism sought to replace and that has made a comeback in recent decades: Intelligent Design ("ID").

The design argument is very old indeed: if we look at life on our planet, including human life, our intuition tells us that all this beauty, complexity, symmetry, specialization, systems, etc., must originate in some kind of mind, just as our complex tools and devices originate in the minds of humans.

One of the classic formulations of ID comes from the theologian William Paley, who asked: if you were to find a watch in the woods, wouldn't you assume that it had been thought of and assembled by an intelligent being? And wouldn't the same be true for the living beings we find in nature? This is the analogy that gave Richard Dawkins' book The Blind Watchmaker its title. Dawkins, of course, argues that the "blind" process of Darwinian evolution could explain the "watch" - meaning organisms, including humans.

A more modern and bare bones formulation of the design argument goes something like this:

quote big

The design argument

  1. The only known way to increase functional complexity in any system is through the infusion of information, which Darwinism cannot explain.
  2. Life forms developed additional complex systems.
  3. Therefore, there must have been an infusion of information, which Darwinism cannot explain, and since the only known cause of information is intelligence, then intelligence must have caused it, hence "intelligent design".

Since you can be sure that this argument will seriously provoke Darwinists, let's look at some of the arguments against ID. This will also help us understand the argument better.

First, there are "arguments" against ID that don't even deserve to be called arguments. Let's get them out of the way.

Intelligent Design and Darwinism

The best-known of these is probably the accusation that Intelligent Design proponents are "biased". Since many, if not most, of the ID proponents are religious, so the story goes, they already made up their minds before they even started their investigation. They want ID to be true, because they are emotionally invested in their belief in God; therefore, they cook up a cocktail of pseudo-science to get there.

The objection to this "argument" is simple. Even if this assumption is true, it doesn't change the actual argument for ID in the least (and by the way, the same argument could be made against Darwinists - that they've already made up their minds that ID cannot be true). The propositions a) and b) above have nothing to do with belief in God, with emotional investment or "bias". They simply are what they are, and either you can refute them or you cannot.

To illustrate this point, suppose I'm a militant atheist and I'm hell-bent on disproving the existence of the historical Jesus. I then advance a powerful argument, based on historical research and rational reasoning, that Jesus didn't exist in any shape or form that the bible claims. Now, if you want to attack my argument, you need to show precisely where my historical facts might be wrong, or where my reasoning might have gone wrong. Simply accusing me of being biased because I'm an atheist is not a valid argument. The most you could reasonably claim is that my atheism makes you suspicious of my reasoning and that you will, therefore, pay particular attention to the details of my claims. But of course, that's what you should do anyway if you want to uncover the truth. In fact, when you dismiss someone else's claim as 'biased' simply because of what they believe, you discredit your own dedication to the truth and open yourself to being accused of bias.

Another of the most frequent (and poorest) strategies Darwinians use to attack the design argument is the time-honoured practice of erecting straw-men and then tearing them down, loudly and proudly of course, which makes the whole spectacle even more pathetic. Here's a (very) partial list of such straw-men:

  • You believe in the bible more than science.
  • You believe the earth was created 6000 years ago.
  • You believe in miracles.
  • You proclaim that organisms were created by God in an instant.
  • You deny natural variation.
  • You deny that natural selection exists.
  • You deny that science is the best method to find out the truth.
  • You deny evolution.
  • You deny common ancestry.
  • You are a homophobic bigot.
  • Etc.

Needless to say, none of these claims are even relevant, much less valid, as arguments against the case for ID. For example, the ID argument is completely compatible with the idea that man evolved from monkeys. It doesn't deny that organisms that are less "fit" have a lower chance of survival. It doesn't deny that there are variations within species, or that species are related. The only thing that it argues for is that, whatever happened and however it happened, there must have been some kind of 'ordering force' involved: namely information. And that unless you can explain how information can sponatanously come into existence without some form of intelligence being involved, you must conclude that there was some sort of intelligence involved in the coming into existence of the complex life we see today.

Heck, even Richard Dawkins' theory of 'selfish genes' would fit the bill, given that he proclaims the existence of hyper-intelligent and cunning little monsters (genes) that build organisms and manipulate them into scheming on their behalf in order to make copies of themselves. So they could be the ones that infuse information into the system! But let's not waste too much time making fun of Dawkins. While he may be a decent-enough comedian when it comes to Bible-bashing, as a philosopher he is worse than useless. But then again, Dawkins-bashing is also much fun, so maybe we'll get back to his particular brand of theism later in this series.

So since Intelligent Design doesn't make any wild claims about God waving his magic wand, what's the real problem with it? To put it simply, while ID doesn't assume and certainly doesn't prove god's existence, it is, nevertheless, consistent with the existence of god. And that is what atheists and materialists simply cannot tolerate. You see, Darwinism is not just any old biological theory. It is an avatar for materialism. It is an idol for the denial of any higher intelligence, or even any intelligence at all - higher or not - outside physical brains and similar organs, of anything existing beyond the strictly physical universe. Darwinism, in combination with Darwinism-inspired theories of the origin of life, is the foundational myth for the worship of dead matter. It seeks to do the impossible, namely to explain how a dead universe can come into being from 'nothing' and produce and evolve life, including minds, to the point of staggering complexity and intelligence that we witness every day. That is why ID freaks Darwinians out: it threatens their myth, the cornerstone of their dead-matter-religion.

Darwinists not only believe that their theory has proven that god does not exist - nonsensical as that idea, in and of itself, is - they simply cannot countenance the idea that there is something, anything, going on in the universe that is not explainable as, essentially, 'dead matter randomly floating around'. I wonder what they are so terrified of that they go to such lengths to keep that particular door locked. …

The Crucial Role of Information

But back to our design argument. If you want to argue against ID in a way that is not limited to creating and destroying strawmen and using ad-hominem attacks against the beliefs of ID proponents, you need to attack the propositions (a or b above) or the logic behind the argument. Since the logic is sound, as far as I can see, and proposition b is uncontroversial, the only thing left is to attack proposition a: that the only known way to increase functional complexity in any system is through the infusion of information, which Darwinism cannot explain. This is the approach taken by the more serious Darwinists; after all, Darwin's 'ground-breaking idea' was intended to make this proposition obsolete to begin with.

The claim that evolution is about producing new information should be uncontroversial. New forms of life, new species, new organs, new molecular systems and so on represent new information. The question, then, is this: can the Darwinian mechanism explain how new information can come into existence?

First, it's clear that the environment cannot magically change organisms: Darwinian organisms are supposed to be entirely passive. That is, they don't self-adapt biologically by using any sort of intelligence. If an organism does react to stimuli from the environment, this ability must have been already present in the Darwinian view - either pre-coded genetically or learned, or a combination of the two. But organisms don't grow larger ears or bigger claws because of environmental stimuli. They just react - nothing truly new is ever directly created in them by external stimuli.

This means that something more is needed. In the (neo-)Darwinian view, that something is provided by random changes in DNA, which supposedly can sometimes produce advantageous results that are then 'selected for' in the great struggle for survival. But since the environment cannot directly change organisms, we have a problem: 'natural selection' needs to somehow already have something to select for - it needs raw material! The whole theory of Darwinism therefore hinges on this question: can random genetic mutations, over long periods of time and in incremental steps, pitted against the environment, produce entirely novel, staggeringly complex systems from relatively primitive ones (which are themselves extremely complex)?

Let's hold on for a second and think about the words 'pitted against'. Darwin's creatures obviously have goals: namely survival and reproduction. I encourage you to think about what that means. Why do creatures want to survive? Does that even make sense in a materialist world? After all, the universe is supposed to be 'blind' - without goal or purpose. So where does this purpose of survival and reproduction come from? Why should the universe care about this or that molecular configuration 'surviving'? Why should the configuration itself care? Indeed, how can it, if it is just dead matter? We should always remember that Darwinism is an avatar for materialism. This is the motivation behind the vitriol Darwinians spew when you ask such questions. Their behavior, especially in online debates and 'comment wars', starts to make sense if we know what's really behind it: a worship of the materialistic, dead universe that, for some reason, they simply cannot renounce.

Random Mutation Doesn't Cut It

Back to our 'information problem'. Can random mutation and natural selection explain the creation of entirely new information?

Let's look at what exactly is postulated here. What kind of change can a 'random mutation' of anything produce? Remember that we are not talking about a skilled genetic engineer at work, we're not talking about consciousness (because that's not allowed). We're talking about change that happens, essentially, by pure luck (or bad luck). So to begin with, it is highly improbable that many genes could change simultaneously in a coordinated fashion, regardless of whether or not the change was beneficial. At best, a single part of the genetic code might change and produce an 'advantageous' (or disadvantageous) effect, or more than one part of the genetic code might change simultaneously, but completely independently of the other part.

The probability that more than one change would happen at the same time and produce a specifically advantageous effect is even more improbable, something like accurately predicting all the lotto numbers over and over and over again. So when talking about random mutation of genes, there is a far higher chance that the change will be disadvantageous, an evolutionary dead end. So for a beneficial change in a gene as a result of random mutation, you need VERY large numbers of such 'experiments' - that are extremely unlikely to happen even to begin with - for something useful to show up, which can then be 'naturally selected'.

But it gets worse: this entire process must, again, be repeated ad nauseam: because once a certain small, useful change manifests and enters the gene pool via natural selection, you need many, many more such changes on top of that to get anywhere useful from an evolutionary point of view. Just think about the difference between, say, a one-celled organism and a deer, and you begin to see why the intuition so many people have always had might be right: the numbers just don't add up; not even close. And it does Darwinians no good to invoke nebulous concepts such as 'Deep Time' to make the problem go away. (For reference, according to Wikipedia, the time it took for man to evolve from the great apes was 10 million years - that's just 5000 times the time from Christ to the present.)

Random Changes Degenerate Code

But the trouble for Darwin's theory runs even deeper. The question is: what effects, exactly, can theoretically be produced if a code is 'randomly changed'? Can random mutations produce a code that contains entirely new information - even if we allow unlimited consecutive mutations? If you put the question that way, the answer is obvious: no! Randomly changing a code is synonymous with degrading it - you lose information!

Some of the cleverer Darwinians recognize the problem. One strategy they use is to deny that the genetic code is really a code. In other words, they 'pull a Dawkins': no, rest assured, we don't really mean it when we talk about codes (or conscious genes plotting world domination, in Dawkins' case). In reality, this is all just billiard balls bouncing around randomly! We could, if we wanted, express all of this in non-code terms! Strangely enough though, biologists keep referring to the genetic code and keep treating it as such. They can't do otherwise, because it is a code.

playerpiano
Perforated paper for automatic pianos:
try randomly changing that!

But let's assume that despite the fact that it looks like a duck etc. (heck, the genetic code literally has letters!), this really is just a bunch of molecules 'causing stuff' in a purely mechanical way. Say, like a piano where you randomly push a key and then a hammer hits the string, except that the process is more complicated and convoluted in the case of genetics.

Now imagine one of these automatic pianos from Western movies. You could say of course that this is just a mechanical process that translates holes in the perforated paper into hammers hitting strings. But the crucial thing here is that it's more than just that: the whole process produces a complex structure of an altogether different type. In this case: music! The reason is that the perforated paper driving the piano doesn't consist of 'random holes' or even simple patterns, but contains information. It codes for an end-product. And of course, just as with any code, if you 'randomly change' parts of the code (the holes representing notes), the information, and therefore the music, will degenerate. (Although, it must be said, given what passes today for art and music, perhaps Darwinians do have a point that random mutation can produce... something.)

But what about natural selection? Can it change the picture? After all, it's the core idea of Darwinism: it's where the needed information to create new lifeforms is supposed to come from. To stay with our analogy, could a step-by-step process of random mutation and blind application of a simple rule somehow change a children's song on our Western piano into a Beethoven symphony? The analogy gives us a clue about some of the many issues plaguing Darwinism:

  • Random alterations indeed degenerate code. They represent a loss of information. This is obvious in the case of sheet music - as well as in the case of any other code you could think of: text in a book, a computer program, Morse code, etc.
  • This also means that while you might have a lucky mutation that somehow makes the music better, this can only be because of a destruction of information - such as the deletion of a note, the breaking of a motive, etc. You cannot increase the information, such as adding a whole new segment based on an advanced composing technique such as developing a variation based on that initial, good-sounding deletion of a single note.
  • After each 'mutation', the song must be somehow better for it to be selected. That means you cannot reach a result that requires a step that makes the song worse temporarily - like changing a C to a C# before you change other notes as well.
  • You cannot go back - once a mutation is 'selected', this means the song somehow got better after the change; if you were to go back, the song would be worse again and therefore this back-change wouldn't be selected. So you are stuck with it, even though there might have been different changes that would have made the song even better - or different pathways to an even better end product!
  • Notice that just as with Darwinism, we required the choice to be made on the basis of very simple rules. No guiding hand, no anticipation of the end result, no planning is allowed. This means that the entire pathway from the children's song to the symphony needs to be 'random' but without the option of going back after each step - which makes it incredibly unlikely to materialize.

So common sense seems right: you cannot get from a children's song on a Western piano to a symphony by random changes, just as you cannot go from a single-celled organism to a deer based on random mutations. Only informed changes can do that. Only an intelligent mind can produce a complex, coherent symphony.

But it gets worse. The music analogy actually falls short - but not in Darwinism's favour. This is because impossible as the odds are even in that analogy, real 'natural selection' cannot even see (or hear) the new version of the song most of the time. Let's have a look at why that is.

There Is Nothing to Select For

One of the favorite sentences Darwinians use is 'this produced an advantage for the survival of the species and was therefore selected'. But think about it: how exactly does a small mutation, leading to a small improvement, help an organism survive? The problem here is that small improvements, or even large improvements to specific systems, don't necessarily translate to survival or more offspring in any straight-forward way.

Imagine for example that by some evolutionary process, you improve your eyesight by 5%. What are the odds that this will help you survive? It would require a very special situation where, let's say, a tiger is about to eat you but thanks to the small improvement, you see it a second earlier than you would have without the improvement, and the situation was precisely such that this difference of 5% in eyesight saved you. That's an extremely unlikely scenario. What's more, the small change in eyesight does nothing to protect you from freezing to death, breaking your leg and dying, or the innumerable other reasons you might not survive. So how, exactly, can natural selection 'select' this mutation when it does not clearly confer an advantage? Your chances of survival are only marginally better than your peers', and chances are you won't even encounter the situation in which the trait comes in handy. And that's assuming it is even possible for random mutation to produce a 5% improvement in eyesight in the first place.

Giraffen 2
How did the giraffe's long neck evolve?
Despite wild speculations by Darwinians,
the truth is: nobody has the slightest clue.

Or think of a giraffe: perhaps by some random mutation, the neck of one animal gets a tiny bit longer. Does this help it better reach its food? Maybe on some very rare occasions. But if it's a weak giraffe to boot, this won't help. And again, this won't help a bit against the myriad of other threats. How, then, should it 'pass on its genes' better than other giraffes?

All we ever get from Darwinians is wild speculation, often using misleading language such as 'giraffes needed to reach higher trees, therefore they evolved their long necks', as if the collective mind of the giraffe-species somehow decided it would be a good idea to 'evolve' a long neck. And perhaps that's really how it happens, who knows? But of course, this isn't at all what Darwinism proclaims. For a prime-example of the nonsensical drivel Darwinian thinking produces, read this article from the New Scientist about the giraffe's long necks, culminating in the 'explanation' that 'Girls like them long'. When you find yourself resorting to schoolyard humor to convince your audience, you know you are in the presence of 'high science'.

There might be some cases where such scenarios could work, but you get the point: a random mutation that miraculously produces something slightly beneficial and is then somehow magically preserved or 'selected' is massively improbable. A whole lot more needs to happen. The signal of the tiny piece of new information, should it even manifest, would be drowned out in a sea of noise: namely the vast majority of scenarios where this specific, tiny advantage doesn't help one bit.

Rather, the way variation and selection seems to work in cases like the giraffe is this: a population has a range of variation for a particular trait, e.g. beak size, in the case of Darwin's famous finches. New conditions favoring a long beak will cause those with beaks too short to die, and new generations will tend to have a larger number of these long beaks - because there are already enough individuals with the now optimal beak length. But nothing new has been created. New finch species might have smaller or larger beaks, but they all fall within the initial range. An abnormally long beak - or neck in the case of the giraffe - requires multiple additional new traits to make it work, and they must all come together at the same time. Naturally, this only compounds the problem described above.

Now, what does this all mean? Just this: that our initial argument is valid. There must be some kind of information coming from somewhere to explain how you get from no life to the first life form and from primitive life to the incredibly complex life forms we observe today. And however this works, it cannot work as Darwinism claims. This also means that materialism is in serious trouble: because materialists proclaim, after all, that the whole universe consists of nothing but dead matter floating around, obeying the physical laws but nothing else. In that view, there is no pre-existing information that could save the day; no plan, no purpose, no guidance, no intelligence, no infusion of information. Remember, to defend this position was the whole point of Darwinism! If Darwinism goes out of the window, so does materialism, unless someone can explain how a universe of dead matter obeying the natural laws can produce information in the form of a code. So far, no one has been able to do so, because it is physically and mathematically impossible.

Now, religious folks will be quick to claim that God is the answer. And that may be the case. But there are other options, including a view of the Cosmos as a living system where information reigns supreme. Where minds, not matter, are the real 'movers and shakers'. Or even where this distinction must be given up altogether: where matter is an active part of a greater mind and all is connected and mutually exchanging information. But let's stop here for the time being, and I hope to see you in the next part of this series!

Further reading:

  • Michael J. Behe: Darwin's Black Box: The Biochemical Challenge to Evolution
  • Michael J. Behe: The Edge of Evolution: The Search for the Limits of Darwinism
  • Perry Marshall: Evolution 2.0: Breaking the Deadlock Between Darwin and Design
  • David Stove: Darwinian Fairytales: Selfish Genes, Errors of Heredity and Other Fables of Evolution
In Cambrian Explosion Debate, Intelligent Design Wins by Default
Anomalocaris 2
Anomalocaris

Sometimes you win a game by default. The loser might not acknowledge losing, but fails to show up.

Picture a world champion prize fighter who has command of the media. He hears a challenger who claims to have a knockout punch, but refuses to get into the ring with him. Instead, he runs to the media and tells them there is indeed a big challenge, and it "might" be winnable. That's it. Reporters run with the story and report, "The Fight Might Be Winnable." Nothing is said about the challenger or his knockout punch. Question: under these circumstances, who wins the fight?

This is the impression you get reading the mainstream media regarding the debate about the Cambrian explosion. Stephen Meyer offered a big challenge in Darwin's Doubt, claiming that Darwinian evolution is not only incapable of explaining the Cambrian event, but that the hierarchical information required to explain almost 20 new body plans that appeared suddenly in Cambrian layers gives positive evidence of intelligent design. His challenge was not lost on Darwin proponents. The book created a strong backlash by evolutionists in blogs, but only one Darwinian got into the ring with Meyer, so to speak, but at least by taking on his challenge. That was "heavyweight" paleontologist Charles Marshall, and a gentlemanly interchange resulted. Meyer answered the response by demonstrating that it did not explain the main point: the origin of the information required to create hierarchical body plans (see Debating Darwin's Doubt, Section III). The challenge stood.

Still Waiting Engagement

The rest of Debating Darwin's Doubt responded to various critics who had taken potshots outside the ring. None of them defeated Meyer's challenge. Paul Nelson wrote in Chapter 34, "Still Waiting Engagement":

quote big

Thus, at the end of the day, it really doesn't matter whether the contemporary evolutionary theorists that Meyer discusses in Darwin's Doubt are attempting to supplement neo-Darwinian theory, replace it with something fundamentally new, or replace some, but not all, parts of the theory. What matters is whether any of these theories can explain what needs to be explained: the origin of novel animal body plans and the biological information necessary to produce them. [Emphasis added.]

That was in 2015. In the four years since, evolutionists have had plenty of opportunity to "engage" and offer their explanation, yet every paper reported here at Evolution News has simply dodged the issue. They pretend the challenge doesn't exist. Instead, they mutter among themselves that "the fight might be winnable," and give the media the impression that Darwin remains the world champion in the heavyweight category of scientific explanation.

The latest is an essay by Michael S. Y. Lee and James B. Dorey in Current Biology, "Evolution: Dampening the Cambrian Explosion." Lee and Dorey practice all the same old moves that failed before. They rely on two recent papers, one already addressed by Evolution News: the one by Deline et al: and another by Graham Budd, who has been cited several times in these pages, most recently here.

A List of Moves

Here's a list of the moves in the new Current Biology paper. This is the latest response by Darwinians about the Cambrian explosion. Keep your eye on the right hook (the origin of biological information) and see if they are ready for it.

  • The Small Explosion move: "Cambrian diversity was not greater than living diversity - at least for arthropods, the most diverse group of animals then and now."
  • The Soft Touch: Sure, arthropods and vertebrates developed hard parts that accelerated their diversification, but "most phyla have either soft bodies (e.g. annelids, nematodes) or simple and relatively inert skeletons (mollusks, brachiopods), and remain largely confined to aqueous environments."
  • The Distraction: The Burgess Shale Cambrian animals failed to fit into living phyla, but "when viewed from the perspective of the Cambrian explosion, modern birds and beetles would appear even more bizarre."
  • The "Got All Day" feint: "Animal disparity is still increasing, and the extent of post-Cambrian innovation rivals the Cambrian explosion, though admittedly occurring over a longer timeframe."
  • The Promise-to-Fight Later tactic: "more complex phyla indeed have larger genomes" - a result from analysis that "should therefore provide fertile ground for further testing."
  • The Churchill Strategy: "History is written by the victors," Churchill said. Twisting this principle in support of Darwin, they allege that "focusing only on living taxa can give a very distorted view of the dynamics of evolutionary radiations." What we see as an explosion might just be an artifact of having only survivors in the record. Darwin was as busy at the beginning as he is now!
  • Punch at random: "Budd and Mann further speculate that if speciation rates are correlated with rates of morphological and molecular change - an association which has been much debated - then surviving clades would also exhibit elevated rates of phenotypic evolution and genetic change, again due to chance alone."

That's it. Did you see any response to the origin of biological information for new body plans? There's a lot of punching at the air, and hitting at the soft gloves of the sparring partner. Basically, they reaffirm Darwin as the undisputed champion, even without a fair fight. Here's the ending paragraph. They acknowledge a big challenge is afoot, but they tell the media not to overestimate it, promising them that "the fight might be winnable."

quote big

While there is little doubt that the Cambrian explosion represented a massive and rapid proliferation of animal forms and lineages, the two studies caution against overestimating its magnitude [i.e., Meyer "might" be a pushover.] The empirical work of Deline and colleagues demonstrates that the Cambrian did not represent the zenith of animal diversity, and that major innovation continues to this day, while the theoretical study of Budd and Mann suggests that elevated rates in speciation at the base of such radiations might be at least partly attributable to stochastic upswings rather than unusual evolutionary mechanisms.

"Innovation" or Chance Miracles?

You can always trust Darwin to be the world champion eventually, they promise. In Darwinspeak, "innovation" refers to chance miracles, like new body plans appearing suddenly. Those miracles evidently happen more quickly in periods of "stochastic upswings" within the "usual evolutionary mechanisms" (you know: sheer dumb luck). Sometimes, by chance, sheer dumb luck runs faster!

Most amusing in this paper is a suggestion that actually handicaps Darwin more. It's the idea that there might have been even more body plans at the Cambrian that we don't see! This makes perfect sense - if you believe that blind chance has infinite creative power. Since Darwin is always on the move, they speculate, and since history is written by the victors, the explosive evidence in the fossil record might just be an artifact of what survived. Logical, right? Commenting on the Deline paper, they say:

quote big

In a major challenge to the view of unsurpassed Cambrian diversity, all Cambrian fossils fall near (between or within) living phyla: for instance, the famously bizarre Anomalocaris helps link modern velvet worms and arthropods. Thus, at least some gaps between the different body plans of modern phyla are artefacts of extinction of 'intermediate' taxa, rather than fundamental evolutionary discontinuities.

How this will help Darwin in the "major challenge" he admittedly faces (Darwin called the Cambrian explosion "the most obvious and serious objection which can be urged against the theory") is anyone's guess.

quote big

Furthermore, the morphospace occupied by Cambrian forms is much smaller than the morphospace occupied by living forms, even after accounting for non-preservation of soft features in most fossils.

But again, that is not the challenge Meyer makes. It's about disparity, not diversity. They can call it small, but the morphospace includes at least 20, and up to 30, new body plans, each distinctive, bearing complex systems like muscles, nerves, digestive systems, sensory systems, locomotion, and reproductive systems with no precursors in the Precambrian. They all appear suddenly. Where are the "intermediate taxa"? They are nowhere in the rock record, 158 years after Darwin had hoped they would be found.

So that's the situation going on six years after Meyer's challenge. Marshall tried a few practice punches after the book came out, but then left. Bloggers have hooted and hollered from the stands, nothing more. Meyer still stands alone in the ring. He wins by default.

Design from the beginning:
It didn't take long for animals to master physics and engineering  [Source]
Ctenophores: Flashing Paddles

Bathocyroe fosteri
Bathocyroe fosteri, a ctenophore: The first
animal body plans were performing feats that
fascinate — and baffle — research scientists.

Also called sea gooseberries and comb jellies, ctenophores (pronounced TEN-o-fours) are small centimeter-sized marine organisms with rows of cilia, called comb rows or ctenes, which function as paddles for swimming. Though gelatinous and transparent, comb jellies are unrelated to jellyfish (phylum Cnidaria); they have been classified into their own phylum, Ctenophora, characterized by eight of these comb rows. Scientists debate whether ctenophores are the earliest animals that appeared in the Cambrian explosion, as opposed to sponges (phylum Porifera). If so, they arrived with multiple tissues, a nervous system, and a digestive system. That's a lot to account for without any known transitional forms.

Up close, comb jellies look like alien spaceships with flashing lights. Rainbow colors race down the comb rows as the cilia beat in series. There's a puzzle: how do the cilia coordinate their movements? A recent paper in Current Biology by Jokura et al. shows it's not simple.

Japanese scientists from the University of Tsukuba identified a structural protein, CTENO64, that is required to orient each cilium within the "compartmenting lamellae" that hold the comb rows together. Without the protein, the animals couldn't swim. This protein, unique to ctenophores, is "unlike any protein studied to date," they say. To add to Darwin's stomach pains, the ctenophores found in the Cambrian fossil record look just like the ones found swimming today, implying that this protein and the unique comb row structure it supports appeared with a bang and then didn't evolve for 520 million years. Some fossil comb jellies, in fact, were even more complex than modern ones, possessing armored shields.

In a review article in the same issue of Current Biology, Sarah P. Leys compares the structure of comb rows to feathers.

quote big

Consider the feather. It's light yet strong and incredibly effective as a paddle. Yet unlike man-made paddles, it is made of hundreds of thousands of filaments. In fact, most biological structures that function as paddles, moving either air or water, are made of highly aligned filaments. Cilia are essentially tiny filaments that project from the surface of cells. They arise singly or in groups from a single cell and when in groups, the distance between the cilia is what makes them function as a paddle or a rake. [Emphasis added.]

The spacing and orientation of each paddle must be regulated, she goes on to say. Picture rowers in a boat paddling in random directions out of sync; they'd get nowhere fast. "If any animal should have sorted out how to organize cilia properly it's the ctenophore," Leys comments. Indeed, the ctenophore did sort it out (or rather, was given a well-sorted structure at the beginning). The compartmenting lamellae are just the right shape to organize the cilia into well-ordered arrays. CTENO64 orients each cilium properly so that they can beat in sync by "hydrodynamic coupling," something like crowds doing the Wave in a stadium.

But even that's not the whole design story. As Michael Behe showed in Darwin's Black Box when he introduced cilia as irreducibly complex biological machines, and elaborated in The Edge of Evolution, each cilium functions because of the precise arrangement of molecular motors and tracks inside the filament. Leys describes the hierarchical arrangement:

quote big

Cilia themselves are typically well-organized structures: each cilium consists of a ring of nine microtubule pairs surrounding a central pair (together called the axoneme), all enclosed by the cell's membrane. In the ctenophore, thousands of cilia are arranged hexagonally in a structure called the comb plate, and the entire comb plate beats as one.

A micrograph shows the cilia arranged in order like a honeycomb, each one with its ten microtubule pairs. From molecular motors to cilia to lamellae to complete rainbow-flashing organism, it's design all the way up.

Mollusks: Structural Strength and Beauty

You'll love the short video here from the University of Michigan:

Assistant Professor Robert Hovden practically glows with inspiration about nacre, or mother-of-pearl, produced by "simple" mollusks. Nacre is nature's toughest material: lightweight but nearly impossible to crack with the hands, even though it's composed of the same material as chalk. Nacre's combination of hardness and resilience has mystified scientists for eighty years — until now.

quote big

"We humans can make tougher materials using unnatural environments, for example extreme heat and pressure. But we can't replicate the kind of nano-engineering that mollusks have achieved. Combining the two approaches could lead to a spectacular new generation of materials, and this paper is a step in that direction," said Robert Hovden, U-M assistant professor of materials science and engineering.

Researchers have known the basics of nacre's secret for decades — it's made of microscopic "bricks" of a mineral called aragonite, laced together with a "mortar" made of organic material. This bricks-and-mortar arrangement clearly lends strength, but nacre is far stronger than its materials suggest.

By studying electron microscope images of nacre flexing in real time, Hovden's team observed proteins stacked like the bricks of a building, called "tablets," which are bonded with thin protein mortar between courses. They watched what happened when strain was applied and released.

quote big

They found that the "bricks" are actually multisided tablets only a few hundred nanometers in size. Ordinarily, these tablets remain separate, arranged in layers and cushioned by a thin layer of organic "mortar." But when stress is applied to the shells, the "mortar" squishes aside and the tablets lock together, forming what is essentially a solid surface. When the force is removed, the structure springs back, without losing any strength or resilience.

Some man-made materials like plastic can recover their shape, but not completely. They lose strength with each iteration. "Nacre lost none of its resilience in repeated impacts at up to 80 percent of its yield strength," they found. All this in a creature that dates back to the Cambrian explosion!

quote big

It's incredible that a mollusk, which is not the most intelligent creature, is fabricating so many structures across so many scales," Hovden said. "It's fabricating individual molecules of calcium carbonate, arranging them into nano-layered sheets that are glued together with organic material, all the way up to the structure of the shell, which combines nacre with several other materials.

The structure of some mollusk shells, like the chambered nautilus, arouse awe with their exquisite beauty and mathematical precision. Hovden's engaging story is only spoiled momentarily by a bit of Darwinian nonsense tacked on as if by a sense of obligation:

quote big

Nature is handing us these highly optimized structures with millions of years of evolution behind them," he said. "We could never run enough computer simulations to come up with these — they're just there for us to discover.

Crustaceans: Memory Smarts

A maze is for mice, most people think. Who would put a crab in a maze? Scientists at Swansea University did that, New Scientist reports; and what they found surprised them.

quote big

A species of crab can learn to navigate a maze and still remember it up to two weeks later. The discovery demonstrates that crustaceans, which include crabs, lobsters and shrimp, have the cognitive capacity for complex learning, even though they have much smaller brains than many other animals.

"Crustaceans have a brain roughly 10 times less than the size of a bee's in terms of neuronal count," says Edward Pope at Swansea University in the UK.

In mazes involving five changes of direction, the test crabs took a few weeks to learn how to find the reward. Once they learned the route, they remembered it after a two-week gap, even without a treat at the end.

Some of the Cambrian animals resemble crabs. It's not possible to determine whether the first arthropods and crustaceans possessed problem-solving intelligence and memory, but it's a fair inference to believe that they could, Pope implies:

quote big

This study is important because we know that insects, especially ants and bees, have some impressive mental abilities but we haven't really looked for them in their aquatic counterparts. The fact that crabs show a similar ability to insects is, in some ways, not that surprising but it is great to be able to show it so clearly.

Cnidaria: Jellyfish Superpowers

The oldest jellyfish fossil found so far dates to 500 million years ago, but since the record may be biased against soft-bodied organisms, older ones could conceivably be discovered. Some cnidarians (the phylum including corals, jellyfish, and sea anemones) do go back farther into the Precambrian. The earliest jellyfish was clearly a jellyfish. Like most other Cambrian fossils, they exploded onto the scene, with complex stinging cells and all.

Jellyfish have "superpowers" according to news from Tohoku University: notably, the ability to regenerate body parts. Have humans "devolved" that ability?

quote big

Cnidarian jellyfish — named for their stinging cells — have existed on the earth for more than 500 million years. They form part of a unique group of animals that are not bilaterally symmetrical and also possess the capacity to regenerate body parts — a trait most of the complex animals, including humans, have lost.

Regeneration is clearly more complex than speeding up cell division. Cells need to know where to go. They must follow a blueprint to grow and differentiate into the tissues and organs that need replacing.

quote big

To investigate the role of cell proliferation following food uptake in determining body-size growth, appendage shape, and regeneration in Cladonema jellyfish, the researchers examined the distribution of cells that play a key role in DNA replication through cell division, producing new 'daughter' cells that are identical to the original 'parent' cell. They found spatially distinct groups of proliferating cells in the medusa (sexual) life-stage, with cell proliferation in the umbrella-shaped portion of their body being uniform, while cell proliferation in the tentacles was clustered.

After withholding food or blocking cell proliferation using a cell-cycle inhibiting agent, the researchers found body size growth was inhibited, and they also observed defects in tentacle branching, differentiation of stem cells into stinging cells, and regeneration. These results suggest that free-swimming adult jellyfish in the sexual stage possess actively proliferating cells that play a key role in controlling body-size, tentacle shape, and regeneration.

Foresight and Planning

So, from from both fossil and living organisms, it's clear that complex organs and behaviors seen today in arthropods, crustaceans, mollusks, and comb jellies have roots in the first appearances of these animal groups. Some diversification has occurred subsequently, and even some devolution. Working systems from the beginning, however, are best explained by foresight and planning.

Read 424 times

Intelligence

Scholars suggest Human DNA shows signs o…

Human DNA shows signs of being an Invasive Extraterrestrial Parasite   Source Scientists now believe that this DNAmust contain coded information Many scientists have documented that over 95% of Human DNA does not have a known purpose. This DNA has been colloquially referred to as Junk DNA Up to 97% of the human genetic information (DNA)...

Read more

Cosmic Serpent ♦ Excerpts

Cosmic Serpent ♦ Excerpts Some biologists describe DNA as an "ancient high biotechnology," containing "over a hundred trillion times as much information by volume as our most sophisticated information storage devices." Could one still speak of technology in these circumstances? Yes, because there is no other word to qualify this duplicable...

Read more

EvolutionIsTrue™

EvolutionIsTrue™ EvolutionIsTrue™ questions the theory of evolution and includes a series of (8) articles by Mandatory Intellectomy taken from the Sott.net website. Also included are four other articles from the Sott.net website that also examine this topic.

Read more

If DNA is Software, Who Wrote The Code?

Who Wrote The Code? From our experience with computers, we know that all software requires intentional intelligence to create. This raises very deep questions about our very being — and about the objectivity of our science. DNA as software is not merely a metaphor – it is fact.Geneticists now edit DNA as a...

Read more